Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714025862:

Variant ID: vg0714025862 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 14025862
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CATGGTTTGGAATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTATTTAACTGTTTTATTAAATTATGAAATATTTATTAAATGTTGTTTATGCAA[C/A]
TGAGACTATACTATGCCATCCTTTGTTATCCTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTGTGTCATATACTCACCTTGCAATCATTCATCAG

Reverse complement sequence

CTGATGAATGATTGCAAGGTGAGTATATGACACACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAGGATAACAAAGGATGGCATAGTATAGTCTCA[G/T]
TTGCATAAACAACATTTAATAAATATTTCATAATTTAATAAAACAGTTAAATAATAATTAAACAATATTAATCCAACGCTATACAACATTCCAAACCATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	25.10%	25.81%	7.36%	NA
All Indica	2759	21.00%	32.60%	37.84%	8.52%	NA
All Japonica	1512	80.90%	2.40%	9.39%	7.28%	NA
Aus	269	14.10%	82.50%	2.97%	0.37%	NA
Indica I	595	46.10%	40.70%	11.09%	2.18%	NA
Indica II	465	19.10%	43.40%	32.26%	5.16%	NA
Indica III	913	2.60%	18.00%	63.20%	16.21%	NA
Indica Intermediate	786	24.60%	37.20%	31.93%	6.36%	NA
Temperate Japonica	767	80.10%	2.00%	6.52%	11.47%	NA
Tropical Japonica	504	92.90%	2.00%	4.96%	0.20%	NA
Japonica Intermediate	241	58.50%	5.00%	27.80%	8.71%	NA
VI/Aromatic	96	83.30%	11.50%	5.21%	0.00%	NA
Intermediate	90	54.40%	20.00%	23.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0714025862	C -> DEL	N	N	silent_mutation	Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0714025862	C -> A	LOC_Os07g24660.1	upstream_gene_variant ; 905.0bp to feature; MODIFIER	silent_mutation	Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0714025862	C -> A	LOC_Os07g24640.1	downstream_gene_variant ; 4284.0bp to feature; MODIFIER	silent_mutation	Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0714025862	C -> A	LOC_Os07g24640-LOC_Os07g24660	intergenic_region ; MODIFIER	silent_mutation	Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0714025862	NA	6.75E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862	NA	3.22E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862	NA	6.85E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862	8.64E-06	NA	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862	1.66E-06	NA	mr1183_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862	NA	5.96E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251