\
| Variant ID: vg0714025862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 14025862 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 76. )
CATGGTTTGGAATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTATTTAACTGTTTTATTAAATTATGAAATATTTATTAAATGTTGTTTATGCAA[C/A]
TGAGACTATACTATGCCATCCTTTGTTATCCTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTGTGTCATATACTCACCTTGCAATCATTCATCAG
CTGATGAATGATTGCAAGGTGAGTATATGACACACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAGGATAACAAAGGATGGCATAGTATAGTCTCA[G/T]
TTGCATAAACAACATTTAATAAATATTTCATAATTTAATAAAACAGTTAAATAATAATTAAACAATATTAATCCAACGCTATACAACATTCCAAACCATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.70% | 25.10% | 25.81% | 7.36% | NA |
| All Indica | 2759 | 21.00% | 32.60% | 37.84% | 8.52% | NA |
| All Japonica | 1512 | 80.90% | 2.40% | 9.39% | 7.28% | NA |
| Aus | 269 | 14.10% | 82.50% | 2.97% | 0.37% | NA |
| Indica I | 595 | 46.10% | 40.70% | 11.09% | 2.18% | NA |
| Indica II | 465 | 19.10% | 43.40% | 32.26% | 5.16% | NA |
| Indica III | 913 | 2.60% | 18.00% | 63.20% | 16.21% | NA |
| Indica Intermediate | 786 | 24.60% | 37.20% | 31.93% | 6.36% | NA |
| Temperate Japonica | 767 | 80.10% | 2.00% | 6.52% | 11.47% | NA |
| Tropical Japonica | 504 | 92.90% | 2.00% | 4.96% | 0.20% | NA |
| Japonica Intermediate | 241 | 58.50% | 5.00% | 27.80% | 8.71% | NA |
| VI/Aromatic | 96 | 83.30% | 11.50% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 20.00% | 23.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0714025862 | C -> DEL | N | N | silent_mutation | Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0714025862 | C -> A | LOC_Os07g24660.1 | upstream_gene_variant ; 905.0bp to feature; MODIFIER | silent_mutation | Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0714025862 | C -> A | LOC_Os07g24640.1 | downstream_gene_variant ; 4284.0bp to feature; MODIFIER | silent_mutation | Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0714025862 | C -> A | LOC_Os07g24640-LOC_Os07g24660 | intergenic_region ; MODIFIER | silent_mutation | Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0714025862 | NA | 6.75E-09 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714025862 | NA | 3.22E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714025862 | NA | 6.85E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714025862 | 8.64E-06 | NA | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714025862 | 1.66E-06 | NA | mr1183_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0714025862 | NA | 5.96E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |