\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0714025862:

Variant ID: vg0714025862 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14025862
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGTTTGGAATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTATTTAACTGTTTTATTAAATTATGAAATATTTATTAAATGTTGTTTATGCAA[C/A]
TGAGACTATACTATGCCATCCTTTGTTATCCTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTGTGTCATATACTCACCTTGCAATCATTCATCAG

Reverse complement sequence

CTGATGAATGATTGCAAGGTGAGTATATGACACACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAGGATAACAAAGGATGGCATAGTATAGTCTCA[G/T]
TTGCATAAACAACATTTAATAAATATTTCATAATTTAATAAAACAGTTAAATAATAATTAAACAATATTAATCCAACGCTATACAACATTCCAAACCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.70% 25.10% 25.81% 7.36% NA
All Indica  2759 21.00% 32.60% 37.84% 8.52% NA
All Japonica  1512 80.90% 2.40% 9.39% 7.28% NA
Aus  269 14.10% 82.50% 2.97% 0.37% NA
Indica I  595 46.10% 40.70% 11.09% 2.18% NA
Indica II  465 19.10% 43.40% 32.26% 5.16% NA
Indica III  913 2.60% 18.00% 63.20% 16.21% NA
Indica Intermediate  786 24.60% 37.20% 31.93% 6.36% NA
Temperate Japonica  767 80.10% 2.00% 6.52% 11.47% NA
Tropical Japonica  504 92.90% 2.00% 4.96% 0.20% NA
Japonica Intermediate  241 58.50% 5.00% 27.80% 8.71% NA
VI/Aromatic  96 83.30% 11.50% 5.21% 0.00% NA
Intermediate  90 54.40% 20.00% 23.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714025862 C -> DEL N N silent_mutation Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0714025862 C -> A LOC_Os07g24660.1 upstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0714025862 C -> A LOC_Os07g24640.1 downstream_gene_variant ; 4284.0bp to feature; MODIFIER silent_mutation Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0714025862 C -> A LOC_Os07g24640-LOC_Os07g24660 intergenic_region ; MODIFIER silent_mutation Average:11.967; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714025862 NA 6.75E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862 NA 3.22E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862 NA 6.85E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862 8.64E-06 NA mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862 1.66E-06 NA mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714025862 NA 5.96E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251