\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713947405:

Variant ID: vg0713947405 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13947405
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGATTTGCCTTGGGCTTCCGCAAACGCTTCGGAACCTTCCTCAACGGAAACGCTCTCCTCCGGAACGTCGGAAACTAAAGCGAAAGAATAAAAATCAA[T/C]
AAAACAGTACAAAAAAACAAGCATAAACAGTACATGTGAATATTTTTAACATGTAGATCTTGATTTTAGAAAAATTTAGCAACTTGAACCACCTGAAACA

Reverse complement sequence

TGTTTCAGGTGGTTCAAGTTGCTAAATTTTTCTAAAATCAAGATCTACATGTTAAAAATATTCACATGTACTGTTTATGCTTGTTTTTTTGTACTGTTTT[A/G]
TTGATTTTTATTCTTTCGCTTTAGTTTCCGACGTTCCGGAGGAGAGCGTTTCCGTTGAGGAAGGTTCCGAAGCGTTTGCGGAAGCCCAAGGCAAATCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 29.80% 1.90% 4.63% NA
All Indica  2759 92.60% 6.60% 0.76% 0.11% NA
All Japonica  1512 7.20% 78.60% 2.58% 11.64% NA
Aus  269 95.50% 1.90% 2.60% 0.00% NA
Indica I  595 82.70% 16.10% 0.84% 0.34% NA
Indica II  465 96.10% 3.40% 0.43% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 89.80% 8.30% 1.78% 0.13% NA
Temperate Japonica  767 5.50% 78.10% 1.04% 15.38% NA
Tropical Japonica  504 4.00% 91.90% 2.18% 1.98% NA
Japonica Intermediate  241 19.50% 52.30% 8.30% 19.92% NA
VI/Aromatic  96 38.50% 1.00% 23.96% 36.46% NA
Intermediate  90 57.80% 36.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713947405 T -> DEL N N silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N
vg0713947405 T -> C LOC_Os07g24498.1 upstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N
vg0713947405 T -> C LOC_Os07g24480.1 downstream_gene_variant ; 1887.0bp to feature; MODIFIER silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N
vg0713947405 T -> C LOC_Os07g24569.1 downstream_gene_variant ; 1053.0bp to feature; MODIFIER silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N
vg0713947405 T -> C LOC_Os07g24510.1 downstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N
vg0713947405 T -> C LOC_Os07g24569-LOC_Os07g24498 intergenic_region ; MODIFIER silent_mutation Average:15.166; most accessible tissue: Callus, score: 22.093 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713947405 2.15E-07 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 3.44E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 6.35E-07 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 2.16E-07 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 1.37E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 5.38E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 2.24E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 6.93E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 1.67E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 5.94E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 1.54E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713947405 NA 8.06E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251