\
| Variant ID: vg0713947405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13947405 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTGATTTGCCTTGGGCTTCCGCAAACGCTTCGGAACCTTCCTCAACGGAAACGCTCTCCTCCGGAACGTCGGAAACTAAAGCGAAAGAATAAAAATCAA[T/C]
AAAACAGTACAAAAAAACAAGCATAAACAGTACATGTGAATATTTTTAACATGTAGATCTTGATTTTAGAAAAATTTAGCAACTTGAACCACCTGAAACA
TGTTTCAGGTGGTTCAAGTTGCTAAATTTTTCTAAAATCAAGATCTACATGTTAAAAATATTCACATGTACTGTTTATGCTTGTTTTTTTGTACTGTTTT[A/G]
TTGATTTTTATTCTTTCGCTTTAGTTTCCGACGTTCCGGAGGAGAGCGTTTCCGTTGAGGAAGGTTCCGAAGCGTTTGCGGAAGCCCAAGGCAAATCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 29.80% | 1.90% | 4.63% | NA |
| All Indica | 2759 | 92.60% | 6.60% | 0.76% | 0.11% | NA |
| All Japonica | 1512 | 7.20% | 78.60% | 2.58% | 11.64% | NA |
| Aus | 269 | 95.50% | 1.90% | 2.60% | 0.00% | NA |
| Indica I | 595 | 82.70% | 16.10% | 0.84% | 0.34% | NA |
| Indica II | 465 | 96.10% | 3.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 8.30% | 1.78% | 0.13% | NA |
| Temperate Japonica | 767 | 5.50% | 78.10% | 1.04% | 15.38% | NA |
| Tropical Japonica | 504 | 4.00% | 91.90% | 2.18% | 1.98% | NA |
| Japonica Intermediate | 241 | 19.50% | 52.30% | 8.30% | 19.92% | NA |
| VI/Aromatic | 96 | 38.50% | 1.00% | 23.96% | 36.46% | NA |
| Intermediate | 90 | 57.80% | 36.70% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713947405 | T -> DEL | N | N | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| vg0713947405 | T -> C | LOC_Os07g24498.1 | upstream_gene_variant ; 323.0bp to feature; MODIFIER | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| vg0713947405 | T -> C | LOC_Os07g24480.1 | downstream_gene_variant ; 1887.0bp to feature; MODIFIER | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| vg0713947405 | T -> C | LOC_Os07g24569.1 | downstream_gene_variant ; 1053.0bp to feature; MODIFIER | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| vg0713947405 | T -> C | LOC_Os07g24510.1 | downstream_gene_variant ; 1310.0bp to feature; MODIFIER | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| vg0713947405 | T -> C | LOC_Os07g24569-LOC_Os07g24498 | intergenic_region ; MODIFIER | silent_mutation | Average:15.166; most accessible tissue: Callus, score: 22.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713947405 | 2.15E-07 | NA | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 3.44E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | 6.35E-07 | NA | mr1140 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | 2.16E-07 | NA | mr1203 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 1.37E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | 5.38E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 2.24E-15 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 6.93E-11 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 1.67E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 5.94E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 1.54E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713947405 | NA | 8.06E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |