\
| Variant ID: vg0713891127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13891127 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAATATAAGCGACATTTGTTGCTTGATCCCCTTTCTATCTTAGCCTCCAACCCTTTAGAACCCATACATGAAATATTAGCCAATAATCCCTATATCTTA[C/T]
AAAGGAGATATTTATACCCCAAACCCAGCCTTTCTTGCCCTTCATCGCTTTCTTGTTATTTTGTGACTTTTATTGAATTTGGTTCTTTCTCTTCTTTAGT
ACTAAAGAAGAGAAAGAACCAAATTCAATAAAAGTCACAAAATAACAAGAAAGCGATGAAGGGCAAGAAAGGCTGGGTTTGGGGTATAAATATCTCCTTT[G/A]
TAAGATATAGGGATTATTGGCTAATATTTCATGTATGGGTTCTAAAGGGTTGGAGGCTAAGATAGAAAGGGGATCAAGCAACAAATGTCGCTTATATTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 0.10% | 2.07% | 6.77% | NA |
| All Indica | 2759 | 93.10% | 0.20% | 2.21% | 4.46% | NA |
| All Japonica | 1512 | 87.20% | 0.10% | 1.72% | 11.04% | NA |
| Aus | 269 | 88.50% | 0.00% | 3.72% | 7.81% | NA |
| Indica I | 595 | 89.60% | 0.30% | 2.35% | 7.73% | NA |
| Indica II | 465 | 94.80% | 0.20% | 3.01% | 1.94% | NA |
| Indica III | 913 | 98.40% | 0.00% | 0.66% | 0.99% | NA |
| Indica Intermediate | 786 | 88.80% | 0.30% | 3.44% | 7.51% | NA |
| Temperate Japonica | 767 | 88.10% | 0.00% | 1.56% | 10.30% | NA |
| Tropical Japonica | 504 | 94.00% | 0.20% | 1.59% | 4.17% | NA |
| Japonica Intermediate | 241 | 69.70% | 0.00% | 2.49% | 27.80% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713891127 | C -> DEL | N | N | silent_mutation | Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0713891127 | C -> T | LOC_Os07g24400.1 | upstream_gene_variant ; 1690.0bp to feature; MODIFIER | silent_mutation | Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0713891127 | C -> T | LOC_Os07g24390.1 | downstream_gene_variant ; 3234.0bp to feature; MODIFIER | silent_mutation | Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0713891127 | C -> T | LOC_Os07g24390-LOC_Os07g24400 | intergenic_region ; MODIFIER | silent_mutation | Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713891127 | NA | 4.00E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713891127 | 1.31E-06 | NA | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713891127 | NA | 4.14E-06 | mr1677 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713891127 | 5.39E-06 | NA | mr1986 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713891127 | 1.43E-06 | 1.43E-06 | mr1986 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |