\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713891127:

Variant ID: vg0713891127 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13891127
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATATAAGCGACATTTGTTGCTTGATCCCCTTTCTATCTTAGCCTCCAACCCTTTAGAACCCATACATGAAATATTAGCCAATAATCCCTATATCTTA[C/T]
AAAGGAGATATTTATACCCCAAACCCAGCCTTTCTTGCCCTTCATCGCTTTCTTGTTATTTTGTGACTTTTATTGAATTTGGTTCTTTCTCTTCTTTAGT

Reverse complement sequence

ACTAAAGAAGAGAAAGAACCAAATTCAATAAAAGTCACAAAATAACAAGAAAGCGATGAAGGGCAAGAAAGGCTGGGTTTGGGGTATAAATATCTCCTTT[G/A]
TAAGATATAGGGATTATTGGCTAATATTTCATGTATGGGTTCTAAAGGGTTGGAGGCTAAGATAGAAAGGGGATCAAGCAACAAATGTCGCTTATATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 0.10% 2.07% 6.77% NA
All Indica  2759 93.10% 0.20% 2.21% 4.46% NA
All Japonica  1512 87.20% 0.10% 1.72% 11.04% NA
Aus  269 88.50% 0.00% 3.72% 7.81% NA
Indica I  595 89.60% 0.30% 2.35% 7.73% NA
Indica II  465 94.80% 0.20% 3.01% 1.94% NA
Indica III  913 98.40% 0.00% 0.66% 0.99% NA
Indica Intermediate  786 88.80% 0.30% 3.44% 7.51% NA
Temperate Japonica  767 88.10% 0.00% 1.56% 10.30% NA
Tropical Japonica  504 94.00% 0.20% 1.59% 4.17% NA
Japonica Intermediate  241 69.70% 0.00% 2.49% 27.80% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 94.40% 0.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713891127 C -> DEL N N silent_mutation Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0713891127 C -> T LOC_Os07g24400.1 upstream_gene_variant ; 1690.0bp to feature; MODIFIER silent_mutation Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0713891127 C -> T LOC_Os07g24390.1 downstream_gene_variant ; 3234.0bp to feature; MODIFIER silent_mutation Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0713891127 C -> T LOC_Os07g24390-LOC_Os07g24400 intergenic_region ; MODIFIER silent_mutation Average:56.797; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713891127 NA 4.00E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713891127 1.31E-06 NA mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713891127 NA 4.14E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713891127 5.39E-06 NA mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713891127 1.43E-06 1.43E-06 mr1986 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251