\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713887346:

Variant ID: vg0713887346 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13887346
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGGTTCAGTATCAGCAAGGAGGATCAGCTCAGCCTCAGTTTGCTCCTCAGTACAATCAATTTGAGCCTATACCTCAACAAGCACAAGGGGTGCCTCAG[C/T]
AGAGACCTTGGGCCGATATGTTTGCAGATGTGATGAGAGAGCAGTTTGGGCTTAAGCCAAAGGATACTCGAAACTTGTATCGGCATCCGTACCCTGAGTG

Reverse complement sequence

CACTCAGGGTACGGATGCCGATACAAGTTTCGAGTATCCTTTGGCTTAAGCCCAAACTGCTCTCTCATCACATCTGCAAACATATCGGCCCAAGGTCTCT[G/A]
CTGAGGCACCCCTTGTGCTTGTTGAGGTATAGGCTCAAATTGATTGTACTGAGGAGCAAACTGAGGCTGAGCTGATCCTCCTTGCTGATACTGAACCTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 6.30% 5.16% 14.07% NA
All Indica  2759 69.10% 6.60% 6.67% 17.69% NA
All Japonica  1512 84.70% 4.80% 2.58% 7.94% NA
Aus  269 62.10% 11.90% 6.32% 19.70% NA
Indica I  595 76.10% 9.60% 4.87% 9.41% NA
Indica II  465 71.20% 5.20% 6.02% 17.63% NA
Indica III  913 64.20% 1.50% 9.64% 24.64% NA
Indica Intermediate  786 68.20% 10.90% 4.96% 15.90% NA
Temperate Japonica  767 85.50% 8.70% 2.61% 3.13% NA
Tropical Japonica  504 93.50% 0.20% 1.79% 4.56% NA
Japonica Intermediate  241 63.50% 2.10% 4.15% 30.29% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 84.40% 6.70% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713887346 C -> DEL LOC_Os07g24390.1 N frameshift_variant Average:53.923; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0713887346 C -> T LOC_Os07g24390.1 N stop_gained Average:53.923; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713887346 NA 5.41E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 NA 6.52E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 NA 4.17E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 5.94E-06 5.94E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 NA 7.15E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 NA 9.73E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 2.87E-06 2.87E-06 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713887346 NA 1.09E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251