\
| Variant ID: vg0713719162 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13719162 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, T: 0.43, others allele: 0.00, population size: 61. )
AGGAGTTGCATGCTTGGAGCTGTTTGCAACAAATAAGTCTGGCCTTGTTTGGTTGGGGAAAAATTTTGGGTTTGGTTGTCACATCGGATATACGGACACA[C/T]
ATTTGAAGTATTAAATGTAGTCTAATAACTATAAAAATTACAGATTCCGCTAGGAAAATGAAAGATGAATTTATTAGGCCTAATTAAGAGTAGTGATATA
TATATCACTACTCTTAATTAGGCCTAATAAATTCATCTTTCATTTTCCTAGCGGAATCTGTAATTTTTATAGTTATTAGACTACATTTAATACTTCAAAT[G/A]
TGTGTCCGTATATCCGATGTGACAACCAAACCCAAAATTTTTCCCCAACCAAACAAGGCCAGACTTATTTGTTGCAAACAGCTCCAAGCATGCAACTCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.90% | 26.40% | 1.27% | 42.45% | NA |
| All Indica | 2759 | 40.80% | 1.50% | 1.78% | 55.93% | NA |
| All Japonica | 1512 | 2.40% | 68.70% | 0.46% | 28.44% | NA |
| Aus | 269 | 77.70% | 21.60% | 0.00% | 0.74% | NA |
| Indica I | 595 | 59.80% | 0.80% | 1.34% | 37.98% | NA |
| Indica II | 465 | 16.80% | 2.80% | 3.01% | 77.42% | NA |
| Indica III | 913 | 41.40% | 0.70% | 1.64% | 56.30% | NA |
| Indica Intermediate | 786 | 39.90% | 2.20% | 1.53% | 56.36% | NA |
| Temperate Japonica | 767 | 1.00% | 61.50% | 0.52% | 36.90% | NA |
| Tropical Japonica | 504 | 4.00% | 92.10% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 3.70% | 42.30% | 1.24% | 52.70% | NA |
| VI/Aromatic | 96 | 24.00% | 74.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 21.10% | 42.20% | 3.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713719162 | C -> DEL | N | N | silent_mutation | Average:13.073; most accessible tissue: Callus, score: 45.928 | N | N | N | N |
| vg0713719162 | C -> T | LOC_Os07g24150-LOC_Os07g24160 | intergenic_region ; MODIFIER | silent_mutation | Average:13.073; most accessible tissue: Callus, score: 45.928 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713719162 | NA | 1.60E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 9.76E-15 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 3.02E-26 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 4.36E-06 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 2.07E-20 | mr1146_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 9.84E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 1.21E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 1.01E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 2.28E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 1.90E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 7.02E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 4.71E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 1.77E-19 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713719162 | NA | 6.96E-12 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |