\
| Variant ID: vg0713636558 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13636558 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGGTGGATTCGGCCATTGTCATCGTGGTCGGTGTTAGAGTTTGTGTCGAATATGTGTAGGTCTCGACTGAACTCCGTTATCAAATATCGTGCCTCGGTGT[C/T]
GTCATCGTGTTTGGATCTCCTATGACGTTTCTTCCGCGTTTGATCTCCGATGTGATTTTGAGGCCGGTTTTATAACAGTCGGCATCCGGTGGATCCGGCC
GGCCGGATCCACCGGATGCCGACTGTTATAAAACCGGCCTCAAAATCACATCGGAGATCAAACGCGGAAGAAACGTCATAGGAGATCCAAACACGATGAC[G/A]
ACACCGAGGCACGATATTTGATAACGGAGTTCAGTCGAGACCTACACATATTCGACACAAACTCTAACACCGACCACGATGACAATGGCCGAATCCACCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 34.80% | 0.19% | 1.78% | NA |
| All Indica | 2759 | 94.80% | 5.10% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 2.60% | 96.90% | 0.00% | 0.46% | NA |
| Aus | 269 | 95.20% | 0.70% | 1.12% | 2.97% | NA |
| Indica I | 595 | 97.10% | 2.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.80% | 13.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 1.00% | 98.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 4.40% | 95.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 4.10% | 94.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 27.10% | 3.10% | 3.12% | 66.67% | NA |
| Intermediate | 90 | 55.60% | 40.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713636558 | C -> DEL | N | N | silent_mutation | Average:59.498; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| vg0713636558 | C -> T | LOC_Os07g24050.1 | upstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:59.498; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| vg0713636558 | C -> T | LOC_Os07g24030-LOC_Os07g24050 | intergenic_region ; MODIFIER | silent_mutation | Average:59.498; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713636558 | 4.33E-06 | NA | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | NA | 3.57E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | 8.37E-07 | NA | mr1005 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | 2.78E-06 | NA | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | NA | 1.37E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | NA | 4.51E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713636558 | NA | 4.01E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |