\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713627339:

Variant ID: vg0713627339 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13627339
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGACCGATCTAGGGCATTCTCGCAAAAACTATATCTAACTCCTGGTACCGTTAACACGACACATTGGGTTCACCCTACTAGTTAAACAAACAATAAGC[G/A]
TATAATTGTCGTACCATTATAACTAGTAATATGCCCGTACTAGCGTTACGGTAGTATTTAGTAATGCAAATCAAACAATCAAGAGAATTATATGTTTTGG

Reverse complement sequence

CCAAAACATATAATTCTCTTGATTGTTTGATTTGCATTACTAAATACTACCGTAACGCTAGTACGGGCATATTACTAGTTATAATGGTACGACAATTATA[C/T]
GCTTATTGTTTGTTTAACTAGTAGGGTGAACCCAATGTGTCGTGTTAACGGTACCAGGAGTTAGATATAGTTTTTGCGAGAATGCCCTAGATCGGTCTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 36.10% 0.06% 1.93% NA
All Indica  2759 95.30% 4.50% 0.07% 0.07% NA
All Japonica  1512 1.40% 98.10% 0.00% 0.46% NA
Aus  269 78.10% 17.10% 0.37% 4.46% NA
Indica I  595 98.50% 1.20% 0.17% 0.17% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 87.70% 12.10% 0.13% 0.13% NA
Temperate Japonica  767 1.00% 98.80% 0.00% 0.13% NA
Tropical Japonica  504 0.80% 98.80% 0.00% 0.40% NA
Japonica Intermediate  241 3.70% 94.60% 0.00% 1.66% NA
VI/Aromatic  96 22.90% 8.30% 0.00% 68.75% NA
Intermediate  90 48.90% 46.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713627339 G -> DEL N N silent_mutation Average:39.984; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0713627339 G -> A LOC_Os07g24030.1 downstream_gene_variant ; 2207.0bp to feature; MODIFIER silent_mutation Average:39.984; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0713627339 G -> A LOC_Os07g24030-LOC_Os07g24050 intergenic_region ; MODIFIER silent_mutation Average:39.984; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713627339 NA 1.55E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713627339 NA 2.01E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.76E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 6.67E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.84E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.20E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.79E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 8.88E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 3.26E-33 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.31E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.90E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 5.05E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.13E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.07E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.83E-65 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.44E-76 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 8.91E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 8.53E-38 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.09E-27 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.21E-42 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 4.01E-06 9.66E-45 mr1891 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 5.09E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 3.14E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.07E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.33E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 4.92E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 3.92E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.98E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.08E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 4.97E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 3.49E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 1.82E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 5.11E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713627339 NA 2.58E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251