\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713442761:

Variant ID: vg0713442761 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13442761
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.16, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTGTCAAGTTTTGACAATGCTAAAATTTTAGCAAGAAAGCAATATTGTCAAAATTTTGGCAGGATTTCTTATGTATTGATTATGTATTAATCAAATTT[G/A]
GCAACAAACTAAACGTAGATATTTTTGGCAATTTTACCCAAAAAATAGTATGGTTGAAAATTGTATCAAAATGAACCGGCCCTATAAATGCCATTGTCAC

Reverse complement sequence

GTGACAATGGCATTTATAGGGCCGGTTCATTTTGATACAATTTTCAACCATACTATTTTTTGGGTAAAATTGCCAAAAATATCTACGTTTAGTTTGTTGC[C/T]
AAATTTGATTAATACATAATCAATACATAAGAAATCCTGCCAAAATTTTGACAATATTGCTTTCTTGCTAAAATTTTAGCATTGTCAAAACTTGACAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 6.50% 1.08% 7.07% NA
All Indica  2759 83.20% 4.50% 1.78% 10.51% NA
All Japonica  1512 88.70% 11.30% 0.00% 0.00% NA
Aus  269 85.10% 0.00% 0.37% 14.50% NA
Indica I  595 53.10% 13.10% 4.71% 29.08% NA
Indica II  465 93.30% 0.60% 0.86% 5.16% NA
Indica III  913 99.60% 0.00% 0.11% 0.33% NA
Indica Intermediate  786 81.00% 5.50% 2.04% 11.45% NA
Temperate Japonica  767 86.40% 13.60% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.70% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 87.80% 5.60% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713442761 G -> DEL N N silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.1 upstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23810.1 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.2 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.4 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.6 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.7 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.8 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.3 upstream_gene_variant ; 2562.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23790.5 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23810.2 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23810.4 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23800.1 downstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N
vg0713442761 G -> A LOC_Os07g23800-LOC_Os07g23810 intergenic_region ; MODIFIER silent_mutation Average:80.506; most accessible tissue: Callus, score: 91.042 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0713442761 G A 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713442761 NA 5.27E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713442761 8.91E-06 NA Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713442761 NA 3.47E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713442761 4.21E-07 NA mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 7.91E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 6.28E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 2.35E-06 NA mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 7.09E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.83E-08 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 8.58E-06 mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 3.38E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.06E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 8.19E-06 8.19E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 6.70E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 3.75E-06 5.69E-08 mr1011_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.32E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 4.45E-10 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 3.47E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.74E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.84E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 3.35E-06 1.86E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 5.02E-06 5.15E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 1.77E-06 1.77E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 5.29E-06 3.94E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 2.48E-06 5.32E-06 mr1373_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 9.29E-06 1.23E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 9.80E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.03E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 7.96E-09 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 8.81E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 2.49E-06 1.17E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.97E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.36E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 7.10E-06 5.78E-07 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 5.48E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 9.44E-08 2.83E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.63E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 3.04E-07 4.90E-08 mr1648_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 5.19E-07 5.19E-07 mr1651_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 1.41E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 2.43E-06 2.43E-06 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 1.74E-07 6.37E-09 mr1669_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 3.85E-06 2.16E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 1.37E-06 1.37E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 8.97E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 3.45E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.49E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 2.85E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 6.83E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 NA 8.44E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713442761 1.47E-06 8.02E-07 mr1977_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251