\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713293448:

Variant ID: vg0713293448 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 13293448
Reference Allele: TAlternative Allele: TG,C
Primary Allele: TSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCCTCCTTTTTCTTCGTTTTTTATATCCTCCTTGGGTTGGTGAGGCCGTGGATGAAGAGAGAGAGGATGAGGGAAAATGACAAGCGGAGAGCTGCGT[T/TG,C]
CCACAGGGGAGGGGAGGAGAGTCGATATGCGCTACGAAATCGGAGTAATTAAAAGTAAGGGCGATCTGCTCCTCCCACAACGATTCACCCCTTTTTTTTA

Reverse complement sequence

TAAAAAAAAGGGGTGAATCGTTGTGGGAGGAGCAGATCGCCCTTACTTTTAATTACTCCGATTTCGTAGCGCATATCGACTCTCCTCCCCTCCCCTGTGG[A/CA,G]
ACGCAGCTCTCCGCTTGTCATTTTCCCTCATCCTCTCTCTCTTCATCCACGGCCTCACCAACCCAAGGAGGATATAAAAAACGAAGAAAAAGGAGGAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 0.40% 0.89% 20.63% C: 0.40%
All Indica  2759 82.60% 0.10% 0.36% 16.60% C: 0.25%
All Japonica  1512 71.20% 0.50% 1.98% 25.53% C: 0.73%
Aus  269 79.90% 0.70% 0.37% 18.59% C: 0.37%
Indica I  595 69.20% 0.20% 0.00% 30.59% NA
Indica II  465 90.30% 0.20% 0.00% 9.25% C: 0.22%
Indica III  913 94.40% 0.20% 0.22% 5.04% C: 0.11%
Indica Intermediate  786 74.60% 0.00% 1.02% 23.79% C: 0.64%
Temperate Japonica  767 64.40% 0.30% 3.78% 30.90% C: 0.65%
Tropical Japonica  504 95.60% 0.20% 0.00% 4.17% NA
Japonica Intermediate  241 41.90% 2.10% 0.41% 53.11% C: 2.49%
VI/Aromatic  96 21.90% 4.20% 1.04% 72.92% NA
Intermediate  90 84.40% 3.30% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713293448 T -> DEL N N silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> TG LOC_Os07g23520.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> TG LOC_Os07g23540.1 upstream_gene_variant ; 1360.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> TG LOC_Os07g23520.2 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> TG LOC_Os07g23530.1 downstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> TG LOC_Os07g23520-LOC_Os07g23530 intergenic_region ; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> C LOC_Os07g23520.1 upstream_gene_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> C LOC_Os07g23540.1 upstream_gene_variant ; 1361.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> C LOC_Os07g23520.2 upstream_gene_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> C LOC_Os07g23530.1 downstream_gene_variant ; 356.0bp to feature; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N
vg0713293448 T -> C LOC_Os07g23520-LOC_Os07g23530 intergenic_region ; MODIFIER silent_mutation Average:95.936; most accessible tissue: Minghui63 flag leaf, score: 97.432 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0713293448 T C 0.02 0.02 0.02 0.02 0.03 0.02
vg0713293448 T TG -0.07 -0.2 -0.26 -0.08 -0.11 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713293448 5.18E-06 5.18E-06 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 5.03E-06 5.03E-06 mr1234 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 2.64E-06 2.64E-06 mr1237 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 8.72E-07 8.72E-07 mr1526 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 4.66E-06 5.73E-06 mr1546 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 8.96E-06 8.96E-06 mr1598 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 4.11E-06 4.11E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 6.70E-06 6.70E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 8.28E-06 8.28E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 5.56E-06 5.56E-06 mr1371_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 8.07E-06 8.07E-06 mr1524_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713293448 NA 6.68E-06 mr1682_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251