\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713287889:

Variant ID: vg0713287889 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13287889
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGCTGGTGTGGCCAAAAGGTTCAGTTTTCGGAAATATTTTTTTGAAGTGGTCTATTAATAAAATTAAAAAAAATTAAAAAGTCTAAAAAAAATTCCG[A/C]
AACACATCTCGGTTTGTCAGAGAAGCGACAGCCACCACGGTCAGTGCTTTCACATTTTTCAGAGAAAAAAAACAGAGCTCCTGAATGTTCAACAGTAAGT

Reverse complement sequence

ACTTACTGTTGAACATTCAGGAGCTCTGTTTTTTTTCTCTGAAAAATGTGAAAGCACTGACCGTGGTGGCTGTCGCTTCTCTGACAAACCGAGATGTGTT[T/G]
CGGAATTTTTTTTAGACTTTTTAATTTTTTTTAATTTTATTAATAGACCACTTCAAAAAAATATTTCCGAAAACTGAACCTTTTGGCCACACCAGCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.50% 0.00% 0.00% NA
All Indica  2759 96.50% 3.50% 0.00% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 91.50% 8.50% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713287889 A -> C LOC_Os07g23520.2 3_prime_UTR_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:58.186; most accessible tissue: Minghui63 flower, score: 69.223 N N N N
vg0713287889 A -> C LOC_Os07g23494.1 upstream_gene_variant ; 4225.0bp to feature; MODIFIER silent_mutation Average:58.186; most accessible tissue: Minghui63 flower, score: 69.223 N N N N
vg0713287889 A -> C LOC_Os07g23510.1 upstream_gene_variant ; 2793.0bp to feature; MODIFIER silent_mutation Average:58.186; most accessible tissue: Minghui63 flower, score: 69.223 N N N N
vg0713287889 A -> C LOC_Os07g23520.1 downstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:58.186; most accessible tissue: Minghui63 flower, score: 69.223 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713287889 NA 7.56E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 1.26E-28 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 2.24E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 1.93E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 8.67E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 3.53E-59 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 1.66E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 2.69E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 8.71E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 1.16E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 3.51E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 8.09E-06 NA mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 2.54E-06 4.93E-10 mr1222_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713287889 NA 1.40E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251