\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713262120:

Variant ID: vg0713262120 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13262120
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAGATGACAAAAATTCTTTAGTCTGATGCAACATATTAATGTCGCTGCTTGCTAACAGTATGTCATCCACATAGAGTACTAGTATTATGAATTTTCC[A/T]
CCCTTAGTCTTAATGTAAAAGCAATTATCCACCTCATTCTCCTTAAATCCGAATCTCTTAATTATTTCATCGAATTTAAGGTACCATTGCCTTGACGCTC

Reverse complement sequence

GAGCGTCAAGGCAATGGTACCTTAAATTCGATGAAATAATTAAGAGATTCGGATTTAAGGAGAATGAGGTGGATAATTGCTTTTACATTAAGACTAAGGG[T/A]
GGAAAATTCATAATACTAGTACTCTATGTGGATGACATACTGTTAGCAAGCAGCGACATTAATATGTTGCATCAGACTAAAGAATTTTTGTCATCTAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 26.00% 17.22% 13.42% NA
All Indica  2759 17.30% 42.10% 22.11% 18.48% NA
All Japonica  1512 86.00% 1.50% 8.33% 4.10% NA
Aus  269 50.90% 9.70% 20.07% 19.33% NA
Indica I  595 27.90% 11.10% 37.14% 23.87% NA
Indica II  465 20.90% 19.80% 18.92% 40.43% NA
Indica III  913 9.40% 73.80% 12.27% 4.49% NA
Indica Intermediate  786 16.30% 42.00% 24.05% 17.68% NA
Temperate Japonica  767 83.10% 0.90% 11.73% 4.30% NA
Tropical Japonica  504 97.20% 0.80% 1.39% 0.60% NA
Japonica Intermediate  241 72.20% 5.00% 12.03% 10.79% NA
VI/Aromatic  96 83.30% 1.00% 15.62% 0.00% NA
Intermediate  90 61.10% 17.80% 10.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713262120 A -> DEL LOC_Os07g23480.1 N frameshift_variant Average:13.682; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0713262120 A -> T LOC_Os07g23480.1 synonymous_variant ; p.Gly1723Gly; LOW synonymous_codon Average:13.682; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713262120 4.66E-11 5.99E-28 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 1.71E-09 6.59E-21 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 NA 2.76E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 4.79E-08 5.16E-15 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 5.31E-07 3.57E-12 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 1.85E-08 2.85E-24 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 3.52E-07 7.02E-17 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 NA 1.48E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 1.56E-07 7.76E-16 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713262120 2.43E-07 7.06E-13 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251