\
| Variant ID: vg0713262120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13262120 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 51. )
AATTAGATGACAAAAATTCTTTAGTCTGATGCAACATATTAATGTCGCTGCTTGCTAACAGTATGTCATCCACATAGAGTACTAGTATTATGAATTTTCC[A/T]
CCCTTAGTCTTAATGTAAAAGCAATTATCCACCTCATTCTCCTTAAATCCGAATCTCTTAATTATTTCATCGAATTTAAGGTACCATTGCCTTGACGCTC
GAGCGTCAAGGCAATGGTACCTTAAATTCGATGAAATAATTAAGAGATTCGGATTTAAGGAGAATGAGGTGGATAATTGCTTTTACATTAAGACTAAGGG[T/A]
GGAAAATTCATAATACTAGTACTCTATGTGGATGACATACTGTTAGCAAGCAGCGACATTAATATGTTGCATCAGACTAAAGAATTTTTGTCATCTAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 26.00% | 17.22% | 13.42% | NA |
| All Indica | 2759 | 17.30% | 42.10% | 22.11% | 18.48% | NA |
| All Japonica | 1512 | 86.00% | 1.50% | 8.33% | 4.10% | NA |
| Aus | 269 | 50.90% | 9.70% | 20.07% | 19.33% | NA |
| Indica I | 595 | 27.90% | 11.10% | 37.14% | 23.87% | NA |
| Indica II | 465 | 20.90% | 19.80% | 18.92% | 40.43% | NA |
| Indica III | 913 | 9.40% | 73.80% | 12.27% | 4.49% | NA |
| Indica Intermediate | 786 | 16.30% | 42.00% | 24.05% | 17.68% | NA |
| Temperate Japonica | 767 | 83.10% | 0.90% | 11.73% | 4.30% | NA |
| Tropical Japonica | 504 | 97.20% | 0.80% | 1.39% | 0.60% | NA |
| Japonica Intermediate | 241 | 72.20% | 5.00% | 12.03% | 10.79% | NA |
| VI/Aromatic | 96 | 83.30% | 1.00% | 15.62% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 17.80% | 10.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713262120 | A -> DEL | LOC_Os07g23480.1 | N | frameshift_variant | Average:13.682; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0713262120 | A -> T | LOC_Os07g23480.1 | synonymous_variant ; p.Gly1723Gly; LOW | synonymous_codon | Average:13.682; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713262120 | 4.66E-11 | 5.99E-28 | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 1.71E-09 | 6.59E-21 | mr1133 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | NA | 2.76E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 4.79E-08 | 5.16E-15 | mr1667 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 5.31E-07 | 3.57E-12 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 1.85E-08 | 2.85E-24 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 3.52E-07 | 7.02E-17 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | NA | 1.48E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 1.56E-07 | 7.76E-16 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713262120 | 2.43E-07 | 7.06E-13 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |