\
| Variant ID: vg0713261979 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 13261979 |
| Reference Allele: GC | Alternative Allele: AC,G |
| Primary Allele: GC | Secondary Allele: AC |
Inferred Ancestral Allele: Not determined.
CAGAGCACTTACTCATATTATATCTTTCTGATACTCTGCTAATGTATGATTTCTGAGATAATCCCAGTACTCCTTTAGACCTATCTCGGTGTATTTCAAT[GC/AC,G]
CTAAAACATAAGATGCCTCACCGAGATCCTTCATATCAAAATTAGATGACAAAAATTCTTTAGTCTGATGCAACATATTAATGTCGCTGCTTGCTAACAG
CTGTTAGCAAGCAGCGACATTAATATGTTGCATCAGACTAAAGAATTTTTGTCATCTAATTTTGATATGAAGGATCTCGGTGAGGCATCTTATGTTTTAG[GC/GT,C]
ATTGAAATACACCGAGATAGGTCTAAAGGAGTACTGGGATTATCTCAGAAATCATACATTAGCAGAGTATCAGAAAGATATAATATGAGTAAGTGCTCTG
| Populations | Population Size | Frequency of GC(primary allele) | Frequency of AC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 28.90% | 6.83% | 0.42% | G: 0.04% |
| All Indica | 2759 | 46.20% | 46.30% | 7.47% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 89.70% | 2.10% | 6.75% | 1.32% | G: 0.07% |
| Aus | 269 | 82.90% | 14.10% | 2.97% | 0.00% | NA |
| Indica I | 595 | 78.20% | 14.10% | 7.73% | 0.00% | NA |
| Indica II | 465 | 71.80% | 22.40% | 5.81% | 0.00% | NA |
| Indica III | 913 | 14.10% | 79.50% | 6.24% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 44.10% | 46.20% | 9.67% | 0.00% | NA |
| Temperate Japonica | 767 | 93.90% | 1.40% | 3.91% | 0.65% | G: 0.13% |
| Tropical Japonica | 504 | 89.90% | 1.00% | 8.73% | 0.40% | NA |
| Japonica Intermediate | 241 | 76.30% | 6.60% | 11.62% | 5.39% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713261979 | GC -> DEL | LOC_Os07g23480.1 | N | frameshift_variant | Average:16.256; most accessible tissue: Minghui63 flag leaf, score: 20.769 | N | N | N | N |
| vg0713261979 | GC -> AC | LOC_Os07g23480.1 | synonymous_variant ; p.Gly1770Gly; LOW | synonymous_codon | Average:16.256; most accessible tissue: Minghui63 flag leaf, score: 20.769 | N | N | N | N |
| vg0713261979 | GC -> G | LOC_Os07g23480.1 | frameshift_variant ; p.Gly1770fs; HIGH | frameshift_variant | Average:16.256; most accessible tissue: Minghui63 flag leaf, score: 20.769 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713261979 | NA | 5.20E-08 | mr1063 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 5.29E-10 | 3.14E-30 | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.11E-08 | 1.94E-22 | mr1133 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | NA | 2.23E-07 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 6.32E-06 | NA | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.94E-06 | 1.94E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | NA | 1.25E-06 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | NA | 2.68E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.70E-07 | 2.55E-16 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 7.59E-07 | 1.20E-13 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 7.53E-06 | 3.75E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | NA | 1.34E-06 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.27E-11 | 1.27E-31 | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.33E-09 | 4.92E-23 | mr1133_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | NA | 2.04E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 1.07E-08 | 6.11E-19 | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261979 | 9.45E-09 | 2.43E-16 | mr1667_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |