\
| Variant ID: vg0713261078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13261078 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 63. )
GGCAATGCGTCAGGGTAGTTATCATGTCCTACCAAGACTCCGGTACCTATAGTTCACTATAAAGCTTCGAAAGAACTCTATCTAATCTTAATGGGAGTTA[G/A]
TTAGGACTAATGCCCCTATTTCCAGGATCTTAGTCTTAATCAAAGGCAATCAGTTATTCCCATTCCGGCTACATGATCTTTAAATAAATTGGGAGGTAAG
CTTACCTCCCAATTTATTTAAAGATCATGTAGCCGGAATGGGAATAACTGATTGCCTTTGATTAAGACTAAGATCCTGGAAATAGGGGCATTAGTCCTAA[C/T]
TAACTCCCATTAAGATTAGATAGAGTTCTTTCGAAGCTTTATAGTGAACTATAGGTACCGGAGTCTTGGTAGGACATGATAACTACCCTGACGCATTGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.60% | 21.70% | 7.28% | 30.41% | NA |
| All Indica | 2759 | 62.30% | 1.60% | 2.43% | 33.74% | NA |
| All Japonica | 1512 | 6.40% | 62.60% | 9.39% | 21.63% | NA |
| Aus | 269 | 29.00% | 1.10% | 24.16% | 45.72% | NA |
| Indica I | 595 | 29.10% | 1.70% | 4.37% | 64.87% | NA |
| Indica II | 465 | 37.60% | 3.70% | 3.23% | 55.48% | NA |
| Indica III | 913 | 93.50% | 0.20% | 1.10% | 5.15% | NA |
| Indica Intermediate | 786 | 65.60% | 1.80% | 2.04% | 30.53% | NA |
| Temperate Japonica | 767 | 5.90% | 63.00% | 3.52% | 27.64% | NA |
| Tropical Japonica | 504 | 2.20% | 75.20% | 20.04% | 2.58% | NA |
| Japonica Intermediate | 241 | 17.00% | 34.90% | 5.81% | 42.32% | NA |
| VI/Aromatic | 96 | 1.00% | 5.20% | 57.29% | 36.46% | NA |
| Intermediate | 90 | 27.80% | 32.20% | 16.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713261078 | G -> DEL | N | N | silent_mutation | Average:12.464; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| vg0713261078 | G -> A | LOC_Os07g23470.1 | upstream_gene_variant ; 2408.0bp to feature; MODIFIER | silent_mutation | Average:12.464; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| vg0713261078 | G -> A | LOC_Os07g23480.1 | downstream_gene_variant ; 40.0bp to feature; MODIFIER | silent_mutation | Average:12.464; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| vg0713261078 | G -> A | LOC_Os07g23470-LOC_Os07g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:12.464; most accessible tissue: Callus, score: 22.145 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713261078 | NA | 3.50E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 8.93E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | 3.83E-06 | 3.83E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | 5.60E-06 | 3.52E-09 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | 1.52E-07 | 5.26E-12 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 1.32E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | 5.28E-06 | 3.27E-17 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 2.88E-11 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 3.31E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 1.93E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713261078 | NA | 3.11E-09 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |