Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713261078:

Variant ID: vg0713261078 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13261078
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAATGCGTCAGGGTAGTTATCATGTCCTACCAAGACTCCGGTACCTATAGTTCACTATAAAGCTTCGAAAGAACTCTATCTAATCTTAATGGGAGTTA[G/A]
TTAGGACTAATGCCCCTATTTCCAGGATCTTAGTCTTAATCAAAGGCAATCAGTTATTCCCATTCCGGCTACATGATCTTTAAATAAATTGGGAGGTAAG

Reverse complement sequence

CTTACCTCCCAATTTATTTAAAGATCATGTAGCCGGAATGGGAATAACTGATTGCCTTTGATTAAGACTAAGATCCTGGAAATAGGGGCATTAGTCCTAA[C/T]
TAACTCCCATTAAGATTAGATAGAGTTCTTTCGAAGCTTTATAGTGAACTATAGGTACCGGAGTCTTGGTAGGACATGATAACTACCCTGACGCATTGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.60%	21.70%	7.28%	30.41%	NA
All Indica	2759	62.30%	1.60%	2.43%	33.74%	NA
All Japonica	1512	6.40%	62.60%	9.39%	21.63%	NA
Aus	269	29.00%	1.10%	24.16%	45.72%	NA
Indica I	595	29.10%	1.70%	4.37%	64.87%	NA
Indica II	465	37.60%	3.70%	3.23%	55.48%	NA
Indica III	913	93.50%	0.20%	1.10%	5.15%	NA
Indica Intermediate	786	65.60%	1.80%	2.04%	30.53%	NA
Temperate Japonica	767	5.90%	63.00%	3.52%	27.64%	NA
Tropical Japonica	504	2.20%	75.20%	20.04%	2.58%	NA
Japonica Intermediate	241	17.00%	34.90%	5.81%	42.32%	NA
VI/Aromatic	96	1.00%	5.20%	57.29%	36.46%	NA
Intermediate	90	27.80%	32.20%	16.67%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713261078	G -> DEL	N	N	silent_mutation	Average:12.464; most accessible tissue: Callus, score: 22.145	N	N	N	N
vg0713261078	G -> A	LOC_Os07g23470.1	upstream_gene_variant ; 2408.0bp to feature; MODIFIER	silent_mutation	Average:12.464; most accessible tissue: Callus, score: 22.145	N	N	N	N
vg0713261078	G -> A	LOC_Os07g23480.1	downstream_gene_variant ; 40.0bp to feature; MODIFIER	silent_mutation	Average:12.464; most accessible tissue: Callus, score: 22.145	N	N	N	N
vg0713261078	G -> A	LOC_Os07g23470-LOC_Os07g23480	intergenic_region ; MODIFIER	silent_mutation	Average:12.464; most accessible tissue: Callus, score: 22.145	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713261078	NA	3.50E-10	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	8.93E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	3.83E-06	3.83E-06	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	5.60E-06	3.52E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	1.52E-07	5.26E-12	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	1.32E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	5.28E-06	3.27E-17	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	2.88E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	3.31E-07	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	1.93E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078	NA	3.11E-09	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251