\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713261078:

Variant ID: vg0713261078 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13261078
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAATGCGTCAGGGTAGTTATCATGTCCTACCAAGACTCCGGTACCTATAGTTCACTATAAAGCTTCGAAAGAACTCTATCTAATCTTAATGGGAGTTA[G/A]
TTAGGACTAATGCCCCTATTTCCAGGATCTTAGTCTTAATCAAAGGCAATCAGTTATTCCCATTCCGGCTACATGATCTTTAAATAAATTGGGAGGTAAG

Reverse complement sequence

CTTACCTCCCAATTTATTTAAAGATCATGTAGCCGGAATGGGAATAACTGATTGCCTTTGATTAAGACTAAGATCCTGGAAATAGGGGCATTAGTCCTAA[C/T]
TAACTCCCATTAAGATTAGATAGAGTTCTTTCGAAGCTTTATAGTGAACTATAGGTACCGGAGTCTTGGTAGGACATGATAACTACCCTGACGCATTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 21.70% 7.28% 30.41% NA
All Indica  2759 62.30% 1.60% 2.43% 33.74% NA
All Japonica  1512 6.40% 62.60% 9.39% 21.63% NA
Aus  269 29.00% 1.10% 24.16% 45.72% NA
Indica I  595 29.10% 1.70% 4.37% 64.87% NA
Indica II  465 37.60% 3.70% 3.23% 55.48% NA
Indica III  913 93.50% 0.20% 1.10% 5.15% NA
Indica Intermediate  786 65.60% 1.80% 2.04% 30.53% NA
Temperate Japonica  767 5.90% 63.00% 3.52% 27.64% NA
Tropical Japonica  504 2.20% 75.20% 20.04% 2.58% NA
Japonica Intermediate  241 17.00% 34.90% 5.81% 42.32% NA
VI/Aromatic  96 1.00% 5.20% 57.29% 36.46% NA
Intermediate  90 27.80% 32.20% 16.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713261078 G -> DEL N N silent_mutation Average:12.464; most accessible tissue: Callus, score: 22.145 N N N N
vg0713261078 G -> A LOC_Os07g23470.1 upstream_gene_variant ; 2408.0bp to feature; MODIFIER silent_mutation Average:12.464; most accessible tissue: Callus, score: 22.145 N N N N
vg0713261078 G -> A LOC_Os07g23480.1 downstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:12.464; most accessible tissue: Callus, score: 22.145 N N N N
vg0713261078 G -> A LOC_Os07g23470-LOC_Os07g23480 intergenic_region ; MODIFIER silent_mutation Average:12.464; most accessible tissue: Callus, score: 22.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713261078 NA 3.50E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 8.93E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 3.83E-06 3.83E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 5.60E-06 3.52E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 1.52E-07 5.26E-12 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 1.32E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 5.28E-06 3.27E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 2.88E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 3.31E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 1.93E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713261078 NA 3.11E-09 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251