\
| Variant ID: vg0713260653 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13260653 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCGGCGATCACCTACGGGGTGGCGGCGGCCTTCCGGTCGCCACCTACTCTGTCCCGGAACAGCAATACGAATCCCTTCCAGCGCAACTGAGAATCGGGA[A/G]
ATTAGGGTTTTGGGATGTCGGGGAGATTGGAACCGTGAGTGAGATCGTCATCTTTCTCACGGGCCGGCCTCCCCTTTTATTTTTTGCGCTGAGGGAATCG
CGATTCCCTCAGCGCAAAAAATAAAAGGGGAGGCCGGCCCGTGAGAAAGATGACGATCTCACTCACGGTTCCAATCTCCCCGACATCCCAAAACCCTAAT[T/C]
TCCCGATTCTCAGTTGCGCTGGAAGGGATTCGTATTGCTGTTCCGGGACAGAGTAGGTGGCGACCGGAAGGCCGCCGCCACCCCGTAGGTGATCGCCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 22.30% | 5.59% | 32.48% | NA |
| All Indica | 2759 | 61.00% | 2.00% | 2.03% | 34.94% | NA |
| All Japonica | 1512 | 6.30% | 62.90% | 6.15% | 24.67% | NA |
| Aus | 269 | 26.00% | 5.60% | 18.96% | 49.44% | NA |
| Indica I | 595 | 28.40% | 1.50% | 3.03% | 67.06% | NA |
| Indica II | 465 | 35.70% | 4.50% | 2.37% | 57.42% | NA |
| Indica III | 913 | 92.70% | 0.00% | 1.75% | 5.59% | NA |
| Indica Intermediate | 786 | 64.00% | 3.20% | 1.40% | 31.42% | NA |
| Temperate Japonica | 767 | 5.90% | 63.40% | 2.74% | 28.03% | NA |
| Tropical Japonica | 504 | 2.00% | 74.80% | 12.70% | 10.52% | NA |
| Japonica Intermediate | 241 | 16.60% | 36.50% | 3.32% | 43.57% | NA |
| VI/Aromatic | 96 | 1.00% | 5.20% | 51.04% | 42.71% | NA |
| Intermediate | 90 | 26.70% | 30.00% | 16.67% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713260653 | A -> DEL | N | N | silent_mutation | Average:8.719; most accessible tissue: Callus, score: 15.682 | N | N | N | N |
| vg0713260653 | A -> G | LOC_Os07g23470.1 | upstream_gene_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:8.719; most accessible tissue: Callus, score: 15.682 | N | N | N | N |
| vg0713260653 | A -> G | LOC_Os07g23480.1 | downstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:8.719; most accessible tissue: Callus, score: 15.682 | N | N | N | N |
| vg0713260653 | A -> G | LOC_Os07g23470-LOC_Os07g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:8.719; most accessible tissue: Callus, score: 15.682 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713260653 | 3.06E-08 | 1.51E-26 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 1.08E-07 | 1.07E-18 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | NA | 4.04E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | NA | 1.58E-06 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | NA | 9.59E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 1.05E-07 | 1.89E-16 | mr1667 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 2.81E-08 | 2.17E-14 | mr1667 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | NA | 2.47E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 8.42E-08 | 1.41E-25 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 5.14E-06 | 1.07E-15 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | NA | 3.71E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 4.54E-07 | 2.68E-16 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713260653 | 2.75E-06 | 8.02E-12 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |