\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713260653:

Variant ID: vg0713260653 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13260653
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGCGATCACCTACGGGGTGGCGGCGGCCTTCCGGTCGCCACCTACTCTGTCCCGGAACAGCAATACGAATCCCTTCCAGCGCAACTGAGAATCGGGA[A/G]
ATTAGGGTTTTGGGATGTCGGGGAGATTGGAACCGTGAGTGAGATCGTCATCTTTCTCACGGGCCGGCCTCCCCTTTTATTTTTTGCGCTGAGGGAATCG

Reverse complement sequence

CGATTCCCTCAGCGCAAAAAATAAAAGGGGAGGCCGGCCCGTGAGAAAGATGACGATCTCACTCACGGTTCCAATCTCCCCGACATCCCAAAACCCTAAT[T/C]
TCCCGATTCTCAGTTGCGCTGGAAGGGATTCGTATTGCTGTTCCGGGACAGAGTAGGTGGCGACCGGAAGGCCGCCGCCACCCCGTAGGTGATCGCCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.70% 22.30% 5.59% 32.48% NA
All Indica  2759 61.00% 2.00% 2.03% 34.94% NA
All Japonica  1512 6.30% 62.90% 6.15% 24.67% NA
Aus  269 26.00% 5.60% 18.96% 49.44% NA
Indica I  595 28.40% 1.50% 3.03% 67.06% NA
Indica II  465 35.70% 4.50% 2.37% 57.42% NA
Indica III  913 92.70% 0.00% 1.75% 5.59% NA
Indica Intermediate  786 64.00% 3.20% 1.40% 31.42% NA
Temperate Japonica  767 5.90% 63.40% 2.74% 28.03% NA
Tropical Japonica  504 2.00% 74.80% 12.70% 10.52% NA
Japonica Intermediate  241 16.60% 36.50% 3.32% 43.57% NA
VI/Aromatic  96 1.00% 5.20% 51.04% 42.71% NA
Intermediate  90 26.70% 30.00% 16.67% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713260653 A -> DEL N N silent_mutation Average:8.719; most accessible tissue: Callus, score: 15.682 N N N N
vg0713260653 A -> G LOC_Os07g23470.1 upstream_gene_variant ; 1983.0bp to feature; MODIFIER silent_mutation Average:8.719; most accessible tissue: Callus, score: 15.682 N N N N
vg0713260653 A -> G LOC_Os07g23480.1 downstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:8.719; most accessible tissue: Callus, score: 15.682 N N N N
vg0713260653 A -> G LOC_Os07g23470-LOC_Os07g23480 intergenic_region ; MODIFIER silent_mutation Average:8.719; most accessible tissue: Callus, score: 15.682 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713260653 3.06E-08 1.51E-26 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 1.08E-07 1.07E-18 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 NA 4.04E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 NA 1.58E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 NA 9.59E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 1.05E-07 1.89E-16 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 2.81E-08 2.17E-14 mr1667 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 NA 2.47E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 8.42E-08 1.41E-25 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 5.14E-06 1.07E-15 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 NA 3.71E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 4.54E-07 2.68E-16 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713260653 2.75E-06 8.02E-12 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251