\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713218164:

Variant ID: vg0713218164 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13218164
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCACCTCTGGCATGCATCAGCAACTGCCACAGCAAGGCTAGGCCCGGGGAGGGGGGGTCATGGACGGTGACAAGCTTGGTGTTGAGCTGGATTTTTCA[C/T]
ATTTTGGTCCTTTTGAAAAACTTATTTCGTAAATAGACCCCTAGAAAAACTTATCCCAAAAATGGTCCTTTTTGGAGCGCCAGAGTGGCTGGCGCCGTCG

Reverse complement sequence

CGACGGCGCCAGCCACTCTGGCGCTCCAAAAAGGACCATTTTTGGGATAAGTTTTTCTAGGGGTCTATTTACGAAATAAGTTTTTCAAAAGGACCAAAAT[G/A]
TGAAAAATCCAGCTCAACACCAAGCTTGTCACCGTCCATGACCCCCCCTCCCCGGGCCTAGCCTTGCTGTGGCAGTTGCTGATGCATGCCAGAGGTGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.30% 7.70% 0.97% 73.04% NA
All Indica  2759 2.10% 0.00% 1.01% 96.85% NA
All Japonica  1512 42.10% 23.70% 0.53% 33.66% NA
Aus  269 24.90% 0.00% 1.86% 73.23% NA
Indica I  595 1.30% 0.00% 1.51% 97.14% NA
Indica II  465 4.50% 0.00% 1.94% 93.55% NA
Indica III  913 1.00% 0.00% 0.55% 98.47% NA
Indica Intermediate  786 2.70% 0.00% 0.64% 96.69% NA
Temperate Japonica  767 63.40% 0.30% 0.65% 35.72% NA
Tropical Japonica  504 13.90% 68.30% 0.40% 17.46% NA
Japonica Intermediate  241 33.60% 5.00% 0.41% 61.00% NA
VI/Aromatic  96 75.00% 0.00% 0.00% 25.00% NA
Intermediate  90 31.10% 7.80% 5.56% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713218164 C -> DEL N N silent_mutation Average:61.056; most accessible tissue: Zhenshan97 root, score: 83.751 N N N N
vg0713218164 C -> T LOC_Os07g23430.1 upstream_gene_variant ; 1516.0bp to feature; MODIFIER silent_mutation Average:61.056; most accessible tissue: Zhenshan97 root, score: 83.751 N N N N
vg0713218164 C -> T LOC_Os07g23410-LOC_Os07g23430 intergenic_region ; MODIFIER silent_mutation Average:61.056; most accessible tissue: Zhenshan97 root, score: 83.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713218164 NA 1.25E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 1.21E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 2.87E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 1.18E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 5.49E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 4.32E-09 mr1277_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 7.44E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 1.36E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 4.31E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 3.94E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 1.15E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 5.71E-07 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 2.97E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 4.14E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 1.12E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 6.23E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713218164 NA 2.78E-17 mr1864_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251