\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713178880:

Variant ID: vg0713178880 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13178880
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGAAGTACATGTTTATTCAGAGTCAATTTTTTTTCTATTGGTATAAATTGAACTTAATCCTTCATGCCTGTGGAGTTACATGTCACATATTTAACTATC[T/A]
TACTATAATTTTTTTATAACTTTTTAAGTGACATGTAAAAACGAGAGGACATTGTTTTAGGAAGAAATGGTGGGAAGGAGTGGAGACCGCCCGGCGTGAG

Reverse complement sequence

CTCACGCCGGGCGGTCTCCACTCCTTCCCACCATTTCTTCCTAAAACAATGTCCTCTCGTTTTTACATGTCACTTAAAAAGTTATAAAAAAATTATAGTA[A/T]
GATAGTTAAATATGTGACATGTAACTCCACAGGCATGAAGGATTAAGTTCAATTTATACCAATAGAAAAAAAATTGACTCTGAATAAACATGTACTTCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 12.70% 0.08% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 61.20% 38.60% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 76.00% 23.60% 0.39% 0.00% NA
Tropical Japonica  504 28.40% 71.60% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713178880 T -> A LOC_Os07g23380.1 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N
vg0713178880 T -> A LOC_Os07g23370.1 downstream_gene_variant ; 2959.0bp to feature; MODIFIER silent_mutation Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N
vg0713178880 T -> A LOC_Os07g23390.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N
vg0713178880 T -> A LOC_Os07g23380-LOC_Os07g23390 intergenic_region ; MODIFIER silent_mutation Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713178880 1.60E-07 NA Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713178880 NA 2.96E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 1.98E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 1.98E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 2.35E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 1.50E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 8.52E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880 NA 5.80E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251