\
| Variant ID: vg0713178880 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13178880 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGAAGTACATGTTTATTCAGAGTCAATTTTTTTTCTATTGGTATAAATTGAACTTAATCCTTCATGCCTGTGGAGTTACATGTCACATATTTAACTATC[T/A]
TACTATAATTTTTTTATAACTTTTTAAGTGACATGTAAAAACGAGAGGACATTGTTTTAGGAAGAAATGGTGGGAAGGAGTGGAGACCGCCCGGCGTGAG
CTCACGCCGGGCGGTCTCCACTCCTTCCCACCATTTCTTCCTAAAACAATGTCCTCTCGTTTTTACATGTCACTTAAAAAGTTATAAAAAAATTATAGTA[A/T]
GATAGTTAAATATGTGACATGTAACTCCACAGGCATGAAGGATTAAGTTCAATTTATACCAATAGAAAAAAAATTGACTCTGAATAAACATGTACTTCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 61.20% | 38.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 76.00% | 23.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 28.40% | 71.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713178880 | T -> A | LOC_Os07g23380.1 | upstream_gene_variant ; 410.0bp to feature; MODIFIER | silent_mutation | Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| vg0713178880 | T -> A | LOC_Os07g23370.1 | downstream_gene_variant ; 2959.0bp to feature; MODIFIER | silent_mutation | Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| vg0713178880 | T -> A | LOC_Os07g23390.1 | downstream_gene_variant ; 3003.0bp to feature; MODIFIER | silent_mutation | Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| vg0713178880 | T -> A | LOC_Os07g23380-LOC_Os07g23390 | intergenic_region ; MODIFIER | silent_mutation | Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713178880 | 1.60E-07 | NA | Plant_height | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0713178880 | NA | 2.96E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 1.98E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 1.98E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 2.35E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 1.50E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 8.52E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713178880 | NA | 5.80E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |