Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713178880:

Variant ID: vg0713178880 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13178880
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGAAGTACATGTTTATTCAGAGTCAATTTTTTTTCTATTGGTATAAATTGAACTTAATCCTTCATGCCTGTGGAGTTACATGTCACATATTTAACTATC[T/A]
TACTATAATTTTTTTATAACTTTTTAAGTGACATGTAAAAACGAGAGGACATTGTTTTAGGAAGAAATGGTGGGAAGGAGTGGAGACCGCCCGGCGTGAG

Reverse complement sequence

CTCACGCCGGGCGGTCTCCACTCCTTCCCACCATTTCTTCCTAAAACAATGTCCTCTCGTTTTTACATGTCACTTAAAAAGTTATAAAAAAATTATAGTA[A/T]
GATAGTTAAATATGTGACATGTAACTCCACAGGCATGAAGGATTAAGTTCAATTTATACCAATAGAAAAAAAATTGACTCTGAATAAACATGTACTTCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	12.70%	0.08%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	61.20%	38.60%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	76.00%	23.60%	0.39%	0.00%	NA
Tropical Japonica	504	28.40%	71.60%	0.00%	0.00%	NA
Japonica Intermediate	241	83.00%	17.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713178880	T -> A	LOC_Os07g23380.1	upstream_gene_variant ; 410.0bp to feature; MODIFIER	silent_mutation	Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0713178880	T -> A	LOC_Os07g23370.1	downstream_gene_variant ; 2959.0bp to feature; MODIFIER	silent_mutation	Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0713178880	T -> A	LOC_Os07g23390.1	downstream_gene_variant ; 3003.0bp to feature; MODIFIER	silent_mutation	Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0713178880	T -> A	LOC_Os07g23380-LOC_Os07g23390	intergenic_region ; MODIFIER	silent_mutation	Average:51.975; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713178880	1.60E-07	NA	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713178880	NA	2.96E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	1.98E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	1.98E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	2.35E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	1.50E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	8.52E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713178880	NA	5.80E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251