\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713136981:

Variant ID: vg0713136981 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13136981
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTAGGGTGGCAGCTGGACTGGGGATCCGCCGCCTCCTGGTGTTAGGCGACTCCCAGCTGGTCGTTAACCAGGTCTGTAAGGAGTATCGGTGCTCTGA[C/T]
CCGCAGATGGACGCTTACGTGCGCCAGGTGCGGCGTATGGAACGCCATTTCGACGGGAAAGAGCTTCGGCACGTGCCCAGACGGGATAACGCGGTCGCCG

Reverse complement sequence

CGGCGACCGCGTTATCCCGTCTGGGCACGTGCCGAAGCTCTTTCCCGTCGAAATGGCGTTCCATACGCCGCACCTGGCGCACGTAAGCGTCCATCTGCGG[G/A]
TCAGAGCACCGATACTCCTTACAGACCTGGTTAACGACCAGCTGGGAGTCGCCTAACACCAGGAGGCGGCGGATCCCCAGTCCAGCTGCCACCCTAAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 4.70% 0.89% 8.89% NA
All Indica  2759 90.80% 7.80% 0.18% 1.20% NA
All Japonica  1512 82.90% 0.10% 0.33% 16.67% NA
Aus  269 45.00% 1.50% 10.78% 42.75% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 94.80% 4.30% 0.22% 0.65% NA
Indica III  913 84.60% 14.80% 0.11% 0.55% NA
Indica Intermediate  786 89.80% 6.60% 0.38% 3.18% NA
Temperate Japonica  767 74.10% 0.00% 0.52% 25.42% NA
Tropical Japonica  504 94.40% 0.20% 0.20% 5.16% NA
Japonica Intermediate  241 87.10% 0.00% 0.00% 12.86% NA
VI/Aromatic  96 90.60% 0.00% 1.04% 8.33% NA
Intermediate  90 83.30% 1.10% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713136981 C -> DEL LOC_Os07g23300.1 N frameshift_variant Average:53.788; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0713136981 C -> T LOC_Os07g23300.1 synonymous_variant ; p.Asp1296Asp; LOW synonymous_codon Average:53.788; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713136981 2.65E-07 2.93E-10 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 6.33E-07 6.37E-09 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 1.42E-07 4.85E-11 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 9.07E-10 9.07E-10 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 2.22E-06 4.13E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 NA 2.10E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 3.70E-06 2.24E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713136981 6.54E-06 1.26E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251