\
| Variant ID: vg0713136981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13136981 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACTTAGGGTGGCAGCTGGACTGGGGATCCGCCGCCTCCTGGTGTTAGGCGACTCCCAGCTGGTCGTTAACCAGGTCTGTAAGGAGTATCGGTGCTCTGA[C/T]
CCGCAGATGGACGCTTACGTGCGCCAGGTGCGGCGTATGGAACGCCATTTCGACGGGAAAGAGCTTCGGCACGTGCCCAGACGGGATAACGCGGTCGCCG
CGGCGACCGCGTTATCCCGTCTGGGCACGTGCCGAAGCTCTTTCCCGTCGAAATGGCGTTCCATACGCCGCACCTGGCGCACGTAAGCGTCCATCTGCGG[G/A]
TCAGAGCACCGATACTCCTTACAGACCTGGTTAACGACCAGCTGGGAGTCGCCTAACACCAGGAGGCGGCGGATCCCCAGTCCAGCTGCCACCCTAAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 4.70% | 0.89% | 8.89% | NA |
| All Indica | 2759 | 90.80% | 7.80% | 0.18% | 1.20% | NA |
| All Japonica | 1512 | 82.90% | 0.10% | 0.33% | 16.67% | NA |
| Aus | 269 | 45.00% | 1.50% | 10.78% | 42.75% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.80% | 4.30% | 0.22% | 0.65% | NA |
| Indica III | 913 | 84.60% | 14.80% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 89.80% | 6.60% | 0.38% | 3.18% | NA |
| Temperate Japonica | 767 | 74.10% | 0.00% | 0.52% | 25.42% | NA |
| Tropical Japonica | 504 | 94.40% | 0.20% | 0.20% | 5.16% | NA |
| Japonica Intermediate | 241 | 87.10% | 0.00% | 0.00% | 12.86% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 83.30% | 1.10% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713136981 | C -> DEL | LOC_Os07g23300.1 | N | frameshift_variant | Average:53.788; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 | N | N | N | N |
| vg0713136981 | C -> T | LOC_Os07g23300.1 | synonymous_variant ; p.Asp1296Asp; LOW | synonymous_codon | Average:53.788; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713136981 | 2.65E-07 | 2.93E-10 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 6.33E-07 | 6.37E-09 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 1.42E-07 | 4.85E-11 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 9.07E-10 | 9.07E-10 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 2.22E-06 | 4.13E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | NA | 2.10E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 3.70E-06 | 2.24E-10 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713136981 | 6.54E-06 | 1.26E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |