\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713133553:

Variant ID: vg0713133553 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13133553
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAGCAGTTCACCATGAACTTCCAGGGCACATATCCGCGCCCAGGTGAAGAAGCGGACTTGCACGCGGTACAGCGAGGGGACGATGAGTCTCTTCGCTC[G/A]
TACATTCAGCGGTTCTGTCAAGTCCGCAACACTATACCATGCATCCCCGCACACGCAGTGATCTATGCGTTCAGGGGGGGCGTGCGGCACAATCGCATGC

Reverse complement sequence

GCATGCGATTGTGCCGCACGCCCCCCCTGAACGCATAGATCACTGCGTGTGCGGGGATGCATGGTATAGTGTTGCGGACTTGACAGAACCGCTGAATGTA[C/T]
GAGCGAAGAGACTCATCGTCCCCTCGCTGTACCGCGTGCAAGTCCGCTTCTTCACCTGGGCGCGGATATGTGCCCTGGAAGTTCATGGTGAACTGCTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 4.40% 0.30% 5.01% NA
All Indica  2759 92.60% 7.10% 0.22% 0.07% NA
All Japonica  1512 84.10% 0.50% 0.33% 15.01% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 86.70% 12.70% 0.55% 0.00% NA
Indica Intermediate  786 93.10% 6.50% 0.13% 0.25% NA
Temperate Japonica  767 73.50% 0.90% 0.52% 25.03% NA
Tropical Japonica  504 96.80% 0.20% 0.00% 2.98% NA
Japonica Intermediate  241 91.30% 0.00% 0.41% 8.30% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 91.10% 1.10% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713133553 G -> DEL LOC_Os07g23300.1 N frameshift_variant Average:39.743; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0713133553 G -> A LOC_Os07g23300.1 synonymous_variant ; p.Ser235Ser; LOW synonymous_codon Average:39.743; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713133553 4.02E-07 1.71E-10 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 3.56E-06 9.94E-09 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 6.30E-06 1.66E-07 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 1.54E-06 6.44E-10 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 2.43E-06 2.43E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 5.83E-07 2.14E-10 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 1.89E-06 6.25E-10 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 NA 7.95E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 1.09E-06 3.70E-11 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553 3.57E-06 3.50E-09 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251