Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0713133553:

Variant ID: vg0713133553 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13133553
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAGCAGTTCACCATGAACTTCCAGGGCACATATCCGCGCCCAGGTGAAGAAGCGGACTTGCACGCGGTACAGCGAGGGGACGATGAGTCTCTTCGCTC[G/A]
TACATTCAGCGGTTCTGTCAAGTCCGCAACACTATACCATGCATCCCCGCACACGCAGTGATCTATGCGTTCAGGGGGGGCGTGCGGCACAATCGCATGC

Reverse complement sequence

GCATGCGATTGTGCCGCACGCCCCCCCTGAACGCATAGATCACTGCGTGTGCGGGGATGCATGGTATAGTGTTGCGGACTTGACAGAACCGCTGAATGTA[C/T]
GAGCGAAGAGACTCATCGTCCCCTCGCTGTACCGCGTGCAAGTCCGCTTCTTCACCTGGGCGCGGATATGTGCCCTGGAAGTTCATGGTGAACTGCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	4.40%	0.30%	5.01%	NA
All Indica	2759	92.60%	7.10%	0.22%	0.07%	NA
All Japonica	1512	84.10%	0.50%	0.33%	15.01%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	86.70%	12.70%	0.55%	0.00%	NA
Indica Intermediate	786	93.10%	6.50%	0.13%	0.25%	NA
Temperate Japonica	767	73.50%	0.90%	0.52%	25.03%	NA
Tropical Japonica	504	96.80%	0.20%	0.00%	2.98%	NA
Japonica Intermediate	241	91.30%	0.00%	0.41%	8.30%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	91.10%	1.10%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713133553	G -> DEL	LOC_Os07g23300.1	N	frameshift_variant	Average:39.743; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0713133553	G -> A	LOC_Os07g23300.1	synonymous_variant ; p.Ser235Ser; LOW	synonymous_codon	Average:39.743; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713133553	4.02E-07	1.71E-10	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	3.56E-06	9.94E-09	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	6.30E-06	1.66E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	1.54E-06	6.44E-10	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	2.43E-06	2.43E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	5.83E-07	2.14E-10	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	1.89E-06	6.25E-10	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	NA	7.95E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	1.09E-06	3.70E-11	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713133553	3.57E-06	3.50E-09	mr1900_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251