\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0713112667:

Variant ID: vg0713112667 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13112667
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGATTGCCATTATGCAAACTTTATATGGAGAGCAATACAATATTCTTTTTGATGGTTGGTTTTTGGGGTGGATAAGAAAAGGAGTAAGCTTGTACTT[G/A]
TGGGAGCCTCTGCAATATGTTGGGCTCTGTGGTTGAGCAGAAAGGATTTGGTTTTTGACAAGTACAATCTTACATGATGGGCAATATTTAAAAAGGAGGG

Reverse complement sequence

CCCTCCTTTTTAAATATTGCCCATCATGTAAGATTGTACTTGTCAAAAACCAAATCCTTTCTGCTCAACCACAGAGCCCAACATATTGCAGAGGCTCCCA[C/T]
AAGTACAAGCTTACTCCTTTTCTTATCCACCCCAAAAACCAACCATCAAAAAGAATATTGTATTGCTCTCCATATAAAGTTTGCATAATGGCAATCCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 37.40% 1.63% 6.75% NA
All Indica  2759 24.40% 61.90% 2.68% 11.05% NA
All Japonica  1512 98.90% 1.00% 0.13% 0.00% NA
Aus  269 97.00% 1.10% 0.00% 1.86% NA
Indica I  595 4.40% 59.20% 5.71% 30.76% NA
Indica II  465 14.20% 78.10% 2.80% 4.95% NA
Indica III  913 39.60% 59.30% 0.77% 0.33% NA
Indica Intermediate  786 27.70% 57.50% 2.54% 12.21% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 12.50% 0.00% 6.25% NA
Intermediate  90 62.20% 33.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0713112667 G -> DEL N N silent_mutation Average:71.126; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0713112667 G -> A LOC_Os07g23270.1 downstream_gene_variant ; 2652.0bp to feature; MODIFIER silent_mutation Average:71.126; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0713112667 G -> A LOC_Os07g23260-LOC_Os07g23270 intergenic_region ; MODIFIER silent_mutation Average:71.126; most accessible tissue: Minghui63 root, score: 88.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0713112667 NA 7.73E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.09E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.73E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 6.81E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 3.58E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 8.26E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 4.43E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.25E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.60E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 1.06E-06 1.06E-06 mr1261_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.12E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.44E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 4.77E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.35E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 5.50E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.47E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 3.11E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.26E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.96E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.82E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 2.43E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 5.47E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713112667 NA 1.14E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251