RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0713088295:

Variant ID: vg0713088295 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13088295
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATGGGAGGCTCAATGTTATTGTGAATGATCTCAAGGGGCTTGGGGCAAACTACACCGATTTTGAGGTTGCCCAAAAGATGCTTAGGGCTCTACCGGAG[A/G]
ATTATGAGACCCTTTTCACCATGCTCATCAACTCCGACATGTCAAGGATGACACCCGCAAGCCTCTTGGGGAAGATCAACACCAATGACATGTACAAGTT

Reverse complement sequence

AACTTGTACATGTCATTGGTGTTGATCTTCCCCAAGAGGCTTGCGGGTGTCATCCTTGACATGTCGGAGTTGATGAGCATGGTGAAAAGGGTCTCATAAT[T/C]
CTCCGGTAGAGCCCTAAGCATCTTTTGGGCAACCTCAAAATCGGTGTAGTTTGCCCCAAGCCCCTTGAGATCATTCACAATAACATTGAGCCTCCCATAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.06%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.11%	0.00%	NA
All Japonica	1512	87.80%	12.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.10%	0.38%	0.00%	NA
Temperate Japonica	767	80.40%	19.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713088295	A -> G	LOC_Os07g23220.1	missense_variant ; p.Asn44Asp; MODERATE	nonsynonymous_codon	Average:34.859; most accessible tissue: Minghui63 flag leaf, score: 64.284	benign	1.122	TOLERATED	0.19

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713088295	NA	5.94E-18	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713088295	NA	1.54E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0713088295	NA	6.37E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	5.64E-06	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	5.78E-06	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	1.09E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	3.90E-13	mr1624	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	8.28E-10	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	6.13E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713088295	NA	1.92E-11	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0713088295:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact