| Variant ID: vg0713003786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 13003786 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGCCCTTCTATCACTTTGTATTTTCTTGACATTAACTGTATTCTTCTTGCTTCTTCTTCTTTTTCTGGAAGTTGTTCACTAACCAAATACTTCAGAATTG[A/G]
CTCTCTCCAATCTATCTCGCCATGTATGTTTGCCACTTCTCTTTTCTCATAACTTGGTTGAATTAACACATCGAAGAATGAATTCTCCAATGGTTGGCCT
AGGCCAACCATTGGAGAATTCATTCTTCGATGTGTTAATTCAACCAAGTTATGAGAAAAGAGAAGTGGCAAACATACATGGCGAGATAGATTGGAGAGAG[T/C]
CAATTCTGAAGTATTTGGTTAGTGAACAACTTCCAGAAAAAGAAGAAGAAGCAAGAAGAATACAGTTAATGTCAAGAAAATACAAAGTGATAGAAGGGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 0.30% | 2.09% | 41.28% | NA |
| All Indica | 2759 | 38.90% | 0.40% | 3.44% | 57.34% | NA |
| All Japonica | 1512 | 92.30% | 0.00% | 0.20% | 7.47% | NA |
| Aus | 269 | 41.60% | 0.00% | 0.00% | 58.36% | NA |
| Indica I | 595 | 74.80% | 0.20% | 1.51% | 23.53% | NA |
| Indica II | 465 | 43.40% | 0.00% | 1.72% | 54.84% | NA |
| Indica III | 913 | 7.30% | 0.70% | 6.46% | 85.54% | NA |
| Indica Intermediate | 786 | 45.50% | 0.40% | 2.42% | 51.65% | NA |
| Temperate Japonica | 767 | 93.70% | 0.00% | 0.26% | 6.00% | NA |
| Tropical Japonica | 504 | 91.30% | 0.00% | 0.00% | 8.73% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 0.41% | 9.54% | NA |
| VI/Aromatic | 96 | 28.10% | 1.00% | 0.00% | 70.83% | NA |
| Intermediate | 90 | 63.30% | 1.10% | 1.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0713003786 | A -> DEL | LOC_Os07g23040.1 | N | frameshift_variant | Average:12.414; most accessible tissue: Callus, score: 36.773 | N | N | N | N |
| vg0713003786 | A -> G | LOC_Os07g23040.1 | missense_variant ; p.Ser74Pro; MODERATE | nonsynonymous_codon ; S74P | Average:12.414; most accessible tissue: Callus, score: 36.773 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0713003786 | NA | 9.35E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713003786 | NA | 4.17E-06 | mr1289 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713003786 | NA | 1.65E-06 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713003786 | NA | 2.46E-06 | mr1788 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713003786 | NA | 1.19E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0713003786 | NA | 3.98E-06 | mr1881 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |