\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712999468:

Variant ID: vg0712999468 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12999468
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGATAGATCTGTGCAGCCGGGTATGGTTGTTCAGGATGGTTGGGCCTGTGCAGCATGGGTGTGCTGTTCAGTGTTGATTAATATTGATGATTAATTA[C/T]
TCTACTGTTTTACAATTCTTAAATATTTTCTAAATGCTGCTTTTGCAAATGAACCCTATATTATGCCATCCTTTGGTATTCTTGTGCACTTGCATATTTG

Reverse complement sequence

CAAATATGCAAGTGCACAAGAATACCAAAGGATGGCATAATATAGGGTTCATTTGCAAAAGCAGCATTTAGAAAATATTTAAGAATTGTAAAACAGTAGA[G/A]
TAATTAATCATCAATATTAATCAACACTGAACAGCACACCCATGCTGCACAGGCCCAACCATCCTGAACAACCATACCCGGCTGCACAGATCTATCTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 1.00% 4.25% 22.37% NA
All Indica  2759 65.50% 0.00% 5.22% 29.32% NA
All Japonica  1512 89.20% 3.00% 2.18% 5.62% NA
Aus  269 56.10% 0.00% 7.43% 36.43% NA
Indica I  595 86.20% 0.00% 3.70% 10.08% NA
Indica II  465 65.40% 0.00% 6.88% 27.74% NA
Indica III  913 48.80% 0.00% 5.04% 46.11% NA
Indica Intermediate  786 69.10% 0.00% 5.60% 25.32% NA
Temperate Japonica  767 87.00% 5.90% 3.26% 3.91% NA
Tropical Japonica  504 91.90% 0.00% 0.60% 7.54% NA
Japonica Intermediate  241 90.90% 0.00% 2.07% 7.05% NA
VI/Aromatic  96 49.00% 0.00% 3.12% 47.92% NA
Intermediate  90 76.70% 1.10% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712999468 C -> DEL N N silent_mutation Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0712999468 C -> T LOC_Os07g23030.1 upstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0712999468 C -> T LOC_Os07g23030.3 upstream_gene_variant ; 3931.0bp to feature; MODIFIER silent_mutation Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0712999468 C -> T LOC_Os07g23040.1 downstream_gene_variant ; 3167.0bp to feature; MODIFIER silent_mutation Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N
vg0712999468 C -> T LOC_Os07g23030-LOC_Os07g23040 intergenic_region ; MODIFIER silent_mutation Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712999468 NA 2.12E-09 mr1028 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 7.50E-07 7.50E-07 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 NA 1.33E-08 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 NA 4.56E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 NA 4.01E-09 mr1652 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 NA 6.41E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712999468 NA 9.72E-06 mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251