\
| Variant ID: vg0712999468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12999468 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGAGATAGATCTGTGCAGCCGGGTATGGTTGTTCAGGATGGTTGGGCCTGTGCAGCATGGGTGTGCTGTTCAGTGTTGATTAATATTGATGATTAATTA[C/T]
TCTACTGTTTTACAATTCTTAAATATTTTCTAAATGCTGCTTTTGCAAATGAACCCTATATTATGCCATCCTTTGGTATTCTTGTGCACTTGCATATTTG
CAAATATGCAAGTGCACAAGAATACCAAAGGATGGCATAATATAGGGTTCATTTGCAAAAGCAGCATTTAGAAAATATTTAAGAATTGTAAAACAGTAGA[G/A]
TAATTAATCATCAATATTAATCAACACTGAACAGCACACCCATGCTGCACAGGCCCAACCATCCTGAACAACCATACCCGGCTGCACAGATCTATCTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 1.00% | 4.25% | 22.37% | NA |
| All Indica | 2759 | 65.50% | 0.00% | 5.22% | 29.32% | NA |
| All Japonica | 1512 | 89.20% | 3.00% | 2.18% | 5.62% | NA |
| Aus | 269 | 56.10% | 0.00% | 7.43% | 36.43% | NA |
| Indica I | 595 | 86.20% | 0.00% | 3.70% | 10.08% | NA |
| Indica II | 465 | 65.40% | 0.00% | 6.88% | 27.74% | NA |
| Indica III | 913 | 48.80% | 0.00% | 5.04% | 46.11% | NA |
| Indica Intermediate | 786 | 69.10% | 0.00% | 5.60% | 25.32% | NA |
| Temperate Japonica | 767 | 87.00% | 5.90% | 3.26% | 3.91% | NA |
| Tropical Japonica | 504 | 91.90% | 0.00% | 0.60% | 7.54% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.00% | 2.07% | 7.05% | NA |
| VI/Aromatic | 96 | 49.00% | 0.00% | 3.12% | 47.92% | NA |
| Intermediate | 90 | 76.70% | 1.10% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712999468 | C -> DEL | N | N | silent_mutation | Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0712999468 | C -> T | LOC_Os07g23030.1 | upstream_gene_variant ; 3931.0bp to feature; MODIFIER | silent_mutation | Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0712999468 | C -> T | LOC_Os07g23030.3 | upstream_gene_variant ; 3931.0bp to feature; MODIFIER | silent_mutation | Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0712999468 | C -> T | LOC_Os07g23040.1 | downstream_gene_variant ; 3167.0bp to feature; MODIFIER | silent_mutation | Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0712999468 | C -> T | LOC_Os07g23030-LOC_Os07g23040 | intergenic_region ; MODIFIER | silent_mutation | Average:19.576; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712999468 | NA | 2.12E-09 | mr1028 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | 7.50E-07 | 7.50E-07 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | NA | 1.33E-08 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | NA | 4.56E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | NA | 4.01E-09 | mr1652 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | NA | 6.41E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712999468 | NA | 9.72E-06 | mr1874_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |