\
| Variant ID: vg0712988935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12988935 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTAACCCTAGCTGCGTGTTTCCGCCTAGCCGCCGCCTAGCCGAGTCAAGTTGTCTTAGTGCCGCCGTGTCGCAGCTGTGTGCCGCTTAAACTTAGCCGCT[G/A]
CTTTTAGTCGAGTTGTGTAGCCGTAGGTGCAACCCTAGGTTCCTACCGGCCTATCGTTTGTCGTACTAGGGCTTTACAGTGAATCGTGTCTAGCCGACCG
CGGTCGGCTAGACACGATTCACTGTAAAGCCCTAGTACGACAAACGATAGGCCGGTAGGAACCTAGGGTTGCACCTACGGCTACACAACTCGACTAAAAG[C/T]
AGCGGCTAAGTTTAAGCGGCACACAGCTGCGACACGGCGGCACTAAGACAACTTGACTCGGCTAGGCGGCGGCTAGGCGGAAACACGCAGCTAGGGTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 6.60% | 7.70% | 49.28% | NA |
| All Indica | 2759 | 26.10% | 0.10% | 10.04% | 63.79% | NA |
| All Japonica | 1512 | 60.90% | 19.90% | 2.78% | 16.40% | NA |
| Aus | 269 | 11.20% | 0.40% | 11.52% | 76.95% | NA |
| Indica I | 595 | 51.90% | 0.20% | 7.23% | 40.67% | NA |
| Indica II | 465 | 30.50% | 0.00% | 8.82% | 60.65% | NA |
| Indica III | 913 | 3.40% | 0.00% | 14.57% | 82.04% | NA |
| Indica Intermediate | 786 | 30.30% | 0.10% | 7.63% | 61.96% | NA |
| Temperate Japonica | 767 | 78.40% | 0.00% | 1.30% | 20.34% | NA |
| Tropical Japonica | 504 | 25.60% | 59.10% | 5.36% | 9.92% | NA |
| Japonica Intermediate | 241 | 79.30% | 1.20% | 2.07% | 17.43% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 7.29% | 83.33% | NA |
| Intermediate | 90 | 44.40% | 10.00% | 7.78% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712988935 | G -> DEL | N | N | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| vg0712988935 | G -> A | LOC_Os07g23020.1 | downstream_gene_variant ; 3769.0bp to feature; MODIFIER | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| vg0712988935 | G -> A | LOC_Os07g23030.1 | downstream_gene_variant ; 696.0bp to feature; MODIFIER | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| vg0712988935 | G -> A | LOC_Os07g23030.2 | downstream_gene_variant ; 696.0bp to feature; MODIFIER | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| vg0712988935 | G -> A | LOC_Os07g23030.3 | downstream_gene_variant ; 2213.0bp to feature; MODIFIER | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| vg0712988935 | G -> A | LOC_Os07g23020-LOC_Os07g23030 | intergenic_region ; MODIFIER | silent_mutation | Average:8.386; most accessible tissue: Callus, score: 13.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712988935 | 2.95E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 7.90E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | 7.05E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 1.43E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | 2.90E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | 3.51E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 1.91E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | 7.52E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | 2.35E-06 | NA | mr1969 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 5.03E-09 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 8.22E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 3.05E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 9.15E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 1.37E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 4.50E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 4.03E-09 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712988935 | NA | 1.13E-08 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |