Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0712988935:

Variant ID: vg0712988935 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12988935
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAACCCTAGCTGCGTGTTTCCGCCTAGCCGCCGCCTAGCCGAGTCAAGTTGTCTTAGTGCCGCCGTGTCGCAGCTGTGTGCCGCTTAAACTTAGCCGCT[G/A]
CTTTTAGTCGAGTTGTGTAGCCGTAGGTGCAACCCTAGGTTCCTACCGGCCTATCGTTTGTCGTACTAGGGCTTTACAGTGAATCGTGTCTAGCCGACCG

Reverse complement sequence

CGGTCGGCTAGACACGATTCACTGTAAAGCCCTAGTACGACAAACGATAGGCCGGTAGGAACCTAGGGTTGCACCTACGGCTACACAACTCGACTAAAAG[C/T]
AGCGGCTAAGTTTAAGCGGCACACAGCTGCGACACGGCGGCACTAAGACAACTTGACTCGGCTAGGCGGCGGCTAGGCGGAAACACGCAGCTAGGGTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	6.60%	7.70%	49.28%	NA
All Indica	2759	26.10%	0.10%	10.04%	63.79%	NA
All Japonica	1512	60.90%	19.90%	2.78%	16.40%	NA
Aus	269	11.20%	0.40%	11.52%	76.95%	NA
Indica I	595	51.90%	0.20%	7.23%	40.67%	NA
Indica II	465	30.50%	0.00%	8.82%	60.65%	NA
Indica III	913	3.40%	0.00%	14.57%	82.04%	NA
Indica Intermediate	786	30.30%	0.10%	7.63%	61.96%	NA
Temperate Japonica	767	78.40%	0.00%	1.30%	20.34%	NA
Tropical Japonica	504	25.60%	59.10%	5.36%	9.92%	NA
Japonica Intermediate	241	79.30%	1.20%	2.07%	17.43%	NA
VI/Aromatic	96	8.30%	1.00%	7.29%	83.33%	NA
Intermediate	90	44.40%	10.00%	7.78%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712988935	G -> DEL	N	N	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N
vg0712988935	G -> A	LOC_Os07g23020.1	downstream_gene_variant ; 3769.0bp to feature; MODIFIER	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N
vg0712988935	G -> A	LOC_Os07g23030.1	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N
vg0712988935	G -> A	LOC_Os07g23030.2	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N
vg0712988935	G -> A	LOC_Os07g23030.3	downstream_gene_variant ; 2213.0bp to feature; MODIFIER	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N
vg0712988935	G -> A	LOC_Os07g23020-LOC_Os07g23030	intergenic_region ; MODIFIER	silent_mutation	Average:8.386; most accessible tissue: Callus, score: 13.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712988935	2.95E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	7.90E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	7.05E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	1.43E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	2.90E-06	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	3.51E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	1.91E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	7.52E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	2.35E-06	NA	mr1969	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	5.03E-09	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	8.22E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	3.05E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	9.15E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	1.37E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	4.50E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	4.03E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712988935	NA	1.13E-08	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251