\
| Variant ID: vg0712942763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12942763 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTATATTCAAAGTATAACATCGGTTTCTAACATCCCTAAATCTCTTAATATAATCAATGACAGATTCATTGTATTTTTGCTTAACCGATGTCAAATCA[C/G,T]
ATAACCTAAGCTCAGTTTCTCCAGTATAGAAATAATCATGAAATTTTTCTTCTAATTGAGCCCAAGTATGAATAGATTTTGCCGGTAAAGAAGTAAACCA
TGGTTTACTTCTTTACCGGCAAAATCTATTCATACTTGGGCTCAATTAGAAGAAAAATTTCATGATTATTTCTATACTGGAGAAACTGAGCTTAGGTTAT[G/C,A]
TGATTTGACATCGGTTAAGCAAAAATACAATGAATCTGTCATTGATTATATTAAGAGATTTAGGGATGTTAGAAACCGATGTTATACTTTGAATATAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 0.60% | 5.99% | 18.58% | G: 0.30% |
| All Indica | 2759 | 66.10% | 0.00% | 6.67% | 26.79% | G: 0.43% |
| All Japonica | 1512 | 87.80% | 1.90% | 4.96% | 5.36% | G: 0.07% |
| Aus | 269 | 81.80% | 0.00% | 5.20% | 13.01% | NA |
| Indica I | 595 | 60.00% | 0.00% | 8.40% | 31.43% | G: 0.17% |
| Indica II | 465 | 62.60% | 0.00% | 5.59% | 31.61% | G: 0.22% |
| Indica III | 913 | 71.40% | 0.00% | 4.71% | 22.89% | G: 0.99% |
| Indica Intermediate | 786 | 66.70% | 0.00% | 8.27% | 24.94% | G: 0.13% |
| Temperate Japonica | 767 | 82.70% | 3.70% | 6.78% | 6.91% | NA |
| Tropical Japonica | 504 | 92.70% | 0.00% | 3.77% | 3.57% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.00% | 1.66% | 4.15% | G: 0.41% |
| VI/Aromatic | 96 | 78.10% | 0.00% | 9.38% | 11.46% | G: 1.04% |
| Intermediate | 90 | 84.40% | 1.10% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712942763 | C -> DEL | LOC_Os07g22960.1 | N | frameshift_variant | Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| vg0712942763 | C -> G | LOC_Os07g22960.1 | missense_variant ; p.Cys664Ser; MODERATE | nonsynonymous_codon ; C664S | Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | benign |
-0.549 |
TOLERATED | 1.00 |
| vg0712942763 | C -> T | LOC_Os07g22960.1 | missense_variant ; p.Cys664Tyr; MODERATE | nonsynonymous_codon ; C664Y | Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | benign |
1.224 |
TOLERATED | 0.08 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712942763 | NA | 7.93E-09 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712942763 | 1.77E-07 | 1.77E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712942763 | NA | 2.28E-08 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712942763 | NA | 1.25E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712942763 | NA | 1.25E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712942763 | NA | 4.86E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |