\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712942763:

Variant ID: vg0712942763 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12942763
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTATATTCAAAGTATAACATCGGTTTCTAACATCCCTAAATCTCTTAATATAATCAATGACAGATTCATTGTATTTTTGCTTAACCGATGTCAAATCA[C/G,T]
ATAACCTAAGCTCAGTTTCTCCAGTATAGAAATAATCATGAAATTTTTCTTCTAATTGAGCCCAAGTATGAATAGATTTTGCCGGTAAAGAAGTAAACCA

Reverse complement sequence

TGGTTTACTTCTTTACCGGCAAAATCTATTCATACTTGGGCTCAATTAGAAGAAAAATTTCATGATTATTTCTATACTGGAGAAACTGAGCTTAGGTTAT[G/C,A]
TGATTTGACATCGGTTAAGCAAAAATACAATGAATCTGTCATTGATTATATTAAGAGATTTAGGGATGTTAGAAACCGATGTTATACTTTGAATATAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 0.60% 5.99% 18.58% G: 0.30%
All Indica  2759 66.10% 0.00% 6.67% 26.79% G: 0.43%
All Japonica  1512 87.80% 1.90% 4.96% 5.36% G: 0.07%
Aus  269 81.80% 0.00% 5.20% 13.01% NA
Indica I  595 60.00% 0.00% 8.40% 31.43% G: 0.17%
Indica II  465 62.60% 0.00% 5.59% 31.61% G: 0.22%
Indica III  913 71.40% 0.00% 4.71% 22.89% G: 0.99%
Indica Intermediate  786 66.70% 0.00% 8.27% 24.94% G: 0.13%
Temperate Japonica  767 82.70% 3.70% 6.78% 6.91% NA
Tropical Japonica  504 92.70% 0.00% 3.77% 3.57% NA
Japonica Intermediate  241 93.80% 0.00% 1.66% 4.15% G: 0.41%
VI/Aromatic  96 78.10% 0.00% 9.38% 11.46% G: 1.04%
Intermediate  90 84.40% 1.10% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712942763 C -> DEL LOC_Os07g22960.1 N frameshift_variant Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0712942763 C -> G LOC_Os07g22960.1 missense_variant ; p.Cys664Ser; MODERATE nonsynonymous_codon ; C664S Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 benign -0.549 TOLERATED 1.00
vg0712942763 C -> T LOC_Os07g22960.1 missense_variant ; p.Cys664Tyr; MODERATE nonsynonymous_codon ; C664Y Average:5.34; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 benign 1.224 TOLERATED 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712942763 NA 7.93E-09 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712942763 1.77E-07 1.77E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712942763 NA 2.28E-08 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712942763 NA 1.25E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712942763 NA 1.25E-08 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712942763 NA 4.86E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251