Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712895377:

Variant ID: vg0712895377 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12895377
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATAAATCAACAAGTTTAGATAATATGCAAAGTTCCTTAATCATCAAAGAATGACAGAAAACAAAATGCATGGAGAATTTTGGTGTCTAGGTCGGTTC[C/T]
GTCCATGGACTACACTGGCCTAACCACCAAAATTCCCCATGCATTTTATATTCTGTGATGGTTTGATAACCTCGGAACTACATTAAACTAGCTAAGATTC

Reverse complement sequence

GAATCTTAGCTAGTTTAATGTAGTTCCGAGGTTATCAAACCATCACAGAATATAAAATGCATGGGGAATTTTGGTGGTTAGGCCAGTGTAGTCCATGGAC[G/A]
GAACCGACCTAGACACCAAAATTCTCCATGCATTTTGTTTTCTGTCATTCTTTGATGATTAAGGAACTTTGCATATTATCTAAACTTGTTGATTTATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	2.10%	0.72%	7.79%	NA
All Indica	2759	98.40%	0.00%	0.04%	1.59%	NA
All Japonica	1512	74.90%	6.40%	1.92%	16.80%	NA
Aus	269	95.90%	0.00%	0.00%	4.09%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	0.00%	0.13%	5.60%	NA
Temperate Japonica	767	71.10%	0.00%	0.78%	28.16%	NA
Tropical Japonica	504	76.60%	19.00%	3.77%	0.60%	NA
Japonica Intermediate	241	83.40%	0.40%	1.66%	14.52%	NA
VI/Aromatic	96	38.50%	0.00%	2.08%	59.38%	NA
Intermediate	90	91.10%	4.40%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712895377	C -> DEL	N	N	silent_mutation	Average:34.461; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0712895377	C -> T	LOC_Os07g22860.1	upstream_gene_variant ; 4409.0bp to feature; MODIFIER	silent_mutation	Average:34.461; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0712895377	C -> T	LOC_Os07g22870.1	upstream_gene_variant ; 298.0bp to feature; MODIFIER	silent_mutation	Average:34.461; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0712895377	C -> T	LOC_Os07g22880.1	downstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:34.461; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0712895377	C -> T	LOC_Os07g22860-LOC_Os07g22870	intergenic_region ; MODIFIER	silent_mutation	Average:34.461; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712895377	NA	2.88E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	2.25E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	9.58E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	3.31E-08	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	2.42E-06	mr1636	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	2.69E-06	2.69E-06	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	2.31E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	5.49E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712895377	NA	7.20E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251