\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712875165:

Variant ID: vg0712875165 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12875165
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAATTCAAGCCAGGGATGGTACAATTAGAGTTTATGGTCTCCCTGAAAATAACATGCATGCCTATTATTCTTTGCTCATTACTTGTTGCTTGTGGTG[A/G]
CATATCCAAAAGGGACCCCATGCTATCTAGGTAATTGATGAATGAGATATAGTCTGATGATAGAAATCCTACAAATCCTACTCTTCATGTTGCACACTTG

Reverse complement sequence

CAAGTGTGCAACATGAAGAGTAGGATTTGTAGGATTTCTATCATCAGACTATATCTCATTCATCAATTACCTAGATAGCATGGGGTCCCTTTTGGATATG[T/C]
CACCACAAGCAACAAGTAATGAGCAAAGAATAATAGGCATGCATGTTATTTTCAGGGAGACCATAAACTCTAATTGTACCATCCCTGGCTTGAATTTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.70% 0.90% 0.42% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 96.00% 2.60% 1.32% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 92.20% 5.20% 2.61% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712875165 A -> G LOC_Os07g22820.1 downstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 N N N N
vg0712875165 A -> G LOC_Os07g22830.1 downstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 N N N N
vg0712875165 A -> G LOC_Os07g22820-LOC_Os07g22830 intergenic_region ; MODIFIER silent_mutation Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712875165 NA 1.02E-07 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 2.26E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 2.05E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 8.64E-08 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 1.80E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 4.66E-06 4.66E-06 mr1915 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 3.15E-06 3.15E-06 mr1081_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 6.56E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 3.95E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 4.29E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 1.55E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712875165 NA 1.18E-06 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251