\
| Variant ID: vg0712875165 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12875165 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 286. )
TTAAAATTCAAGCCAGGGATGGTACAATTAGAGTTTATGGTCTCCCTGAAAATAACATGCATGCCTATTATTCTTTGCTCATTACTTGTTGCTTGTGGTG[A/G]
CATATCCAAAAGGGACCCCATGCTATCTAGGTAATTGATGAATGAGATATAGTCTGATGATAGAAATCCTACAAATCCTACTCTTCATGTTGCACACTTG
CAAGTGTGCAACATGAAGAGTAGGATTTGTAGGATTTCTATCATCAGACTATATCTCATTCATCAATTACCTAGATAGCATGGGGTCCCTTTTGGATATG[T/C]
CACCACAAGCAACAAGTAATGAGCAAAGAATAATAGGCATGCATGTTATTTTCAGGGAGACCATAAACTCTAATTGTACCATCCCTGGCTTGAATTTTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.70% | 0.90% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.00% | 2.60% | 1.32% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.20% | 5.20% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712875165 | A -> G | LOC_Os07g22820.1 | downstream_gene_variant ; 1146.0bp to feature; MODIFIER | silent_mutation | Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
| vg0712875165 | A -> G | LOC_Os07g22830.1 | downstream_gene_variant ; 1776.0bp to feature; MODIFIER | silent_mutation | Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
| vg0712875165 | A -> G | LOC_Os07g22820-LOC_Os07g22830 | intergenic_region ; MODIFIER | silent_mutation | Average:31.388; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712875165 | NA | 1.02E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 2.26E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 2.05E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 8.64E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 1.80E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | 4.66E-06 | 4.66E-06 | mr1915 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | 3.15E-06 | 3.15E-06 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 6.56E-06 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 3.95E-06 | mr1381_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 4.29E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 1.55E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712875165 | NA | 1.18E-06 | mr1986_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |