Variant ID: vg0712655383 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 12655383 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATCATATAGATAAAACAAGAATTTTATCTCCACTTGGTTCTGCAAGGATAGTACATAAGTGACAATCTCATCCAAAATTGTTTCTTCTCACTAACAGGG[G/C]
CTCTAATAAAGTGGAGAATTCGATAATCTGATTCCTCTTGTAAATAGCTACAATTTATCATTATGAAGGATGAAAAAAATAGTTTCATTGTCAGAGATCG
CGATCTCTGACAATGAAACTATTTTTTTCATCCTTCATAATGATAAATTGTAGCTATTTACAAGAGGAATCAGATTATCGAATTCTCCACTTTATTAGAG[C/G]
CCCTGTTAGTGAGAAGAAACAATTTTGGATGAGATTGTCACTTATGTACTATCCTTGCAGAACCAAGTGGAGATAAAATTCTTGTTTTATCTATATGATG
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 27.00% | 15.20% | 0.51% | 57.30% | NA |
All Indica | 2759 | 9.40% | 0.50% | 0.72% | 89.45% | NA |
All Japonica | 1512 | 50.90% | 45.40% | 0.00% | 3.70% | NA |
Aus | 269 | 48.30% | 0.00% | 1.12% | 50.56% | NA |
Indica I | 595 | 0.20% | 0.20% | 1.01% | 98.66% | NA |
Indica II | 465 | 7.10% | 1.30% | 0.86% | 90.75% | NA |
Indica III | 913 | 10.10% | 0.20% | 0.33% | 89.38% | NA |
Indica Intermediate | 786 | 16.80% | 0.50% | 0.89% | 81.81% | NA |
Temperate Japonica | 767 | 74.10% | 24.40% | 0.00% | 1.56% | NA |
Tropical Japonica | 504 | 23.60% | 69.60% | 0.00% | 6.75% | NA |
Japonica Intermediate | 241 | 34.40% | 61.40% | 0.00% | 4.15% | NA |
VI/Aromatic | 96 | 86.50% | 0.00% | 0.00% | 13.54% | NA |
Intermediate | 90 | 41.10% | 18.90% | 1.11% | 38.89% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0712655383 | G -> DEL | N | N | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
vg0712655383 | G -> C | LOC_Os07g22496.1 | upstream_gene_variant ; 4487.0bp to feature; MODIFIER | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
vg0712655383 | G -> C | LOC_Os07g22494.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
vg0712655383 | G -> C | LOC_Os07g22494.4 | intron_variant ; MODIFIER | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
vg0712655383 | G -> C | LOC_Os07g22494.2 | intron_variant ; MODIFIER | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
vg0712655383 | G -> C | LOC_Os07g22494.3 | intron_variant ; MODIFIER | silent_mutation | Average:10.152; most accessible tissue: Callus, score: 53.177 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0712655383 | NA | 4.15E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0712655383 | 8.15E-07 | 5.43E-08 | mr1928 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0712655383 | NA | 1.86E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |