\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712651082:

Variant ID: vg0712651082 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12651082
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGAGTTTCCGAACCTCGGTGAAAAATCCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTACATTTGAGCAAGTTTACATACTAGAGCTTATTTGTG[C/A]
TATTATCACCCTAGGCTTGCAAACCTTAACATATGCTAGTTTCTTTGTGCACTTACTTGAGACTAGTTGATTTAGGTTTTGAATTGTGCAAAACCGTTCT

Reverse complement sequence

AGAACGGTTTTGCACAATTCAAAACCTAAATCAACTAGTCTCAAGTAAGTGCACAAAGAAACTAGCATATGTTAAGGTTTGCAAGCCTAGGGTGATAATA[G/T]
CACAAATAAGCTCTAGTATGTAAACTTGCTCAAATGTAAATGCAACAAATAAATGAGACAAGAGACAAGGGATTTTTCACCGAGGTTCGGAAACTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 0.80% 3.05% 52.20% NA
All Indica  2759 11.70% 1.40% 3.81% 83.11% NA
All Japonica  1512 98.30% 0.00% 0.00% 1.65% NA
Aus  269 47.60% 0.00% 14.50% 37.92% NA
Indica I  595 3.40% 1.70% 5.04% 89.92% NA
Indica II  465 14.20% 0.90% 3.23% 81.72% NA
Indica III  913 9.90% 1.30% 2.85% 85.98% NA
Indica Intermediate  786 18.60% 1.70% 4.33% 75.45% NA
Temperate Japonica  767 98.40% 0.00% 0.00% 1.56% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 85.40% 1.00% 0.00% 13.54% NA
Intermediate  90 62.20% 0.00% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712651082 C -> DEL N N silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22480.1 downstream_gene_variant ; 4538.0bp to feature; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22494.1 downstream_gene_variant ; 1890.0bp to feature; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22494.4 downstream_gene_variant ; 1834.0bp to feature; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22494.2 downstream_gene_variant ; 1885.0bp to feature; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22494.3 downstream_gene_variant ; 1890.0bp to feature; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N
vg0712651082 C -> A LOC_Os07g22480-LOC_Os07g22494 intergenic_region ; MODIFIER silent_mutation Average:14.304; most accessible tissue: Callus, score: 26.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712651082 NA 7.40E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082 4.17E-06 3.35E-08 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082 NA 6.62E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082 7.46E-06 7.41E-08 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251