Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712651082:

Variant ID: vg0712651082 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12651082
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCGAGTTTCCGAACCTCGGTGAAAAATCCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTACATTTGAGCAAGTTTACATACTAGAGCTTATTTGTG[C/A]
TATTATCACCCTAGGCTTGCAAACCTTAACATATGCTAGTTTCTTTGTGCACTTACTTGAGACTAGTTGATTTAGGTTTTGAATTGTGCAAAACCGTTCT

Reverse complement sequence

AGAACGGTTTTGCACAATTCAAAACCTAAATCAACTAGTCTCAAGTAAGTGCACAAAGAAACTAGCATATGTTAAGGTTTGCAAGCCTAGGGTGATAATA[G/T]
CACAAATAAGCTCTAGTATGTAAACTTGCTCAAATGTAAATGCAACAAATAAATGAGACAAGAGACAAGGGATTTTTCACCGAGGTTCGGAAACTCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	0.80%	3.05%	52.20%	NA
All Indica	2759	11.70%	1.40%	3.81%	83.11%	NA
All Japonica	1512	98.30%	0.00%	0.00%	1.65%	NA
Aus	269	47.60%	0.00%	14.50%	37.92%	NA
Indica I	595	3.40%	1.70%	5.04%	89.92%	NA
Indica II	465	14.20%	0.90%	3.23%	81.72%	NA
Indica III	913	9.90%	1.30%	2.85%	85.98%	NA
Indica Intermediate	786	18.60%	1.70%	4.33%	75.45%	NA
Temperate Japonica	767	98.40%	0.00%	0.00%	1.56%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	96.30%	0.00%	0.00%	3.73%	NA
VI/Aromatic	96	85.40%	1.00%	0.00%	13.54%	NA
Intermediate	90	62.20%	0.00%	0.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712651082	C -> DEL	N	N	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22480.1	downstream_gene_variant ; 4538.0bp to feature; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22494.1	downstream_gene_variant ; 1890.0bp to feature; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22494.4	downstream_gene_variant ; 1834.0bp to feature; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22494.2	downstream_gene_variant ; 1885.0bp to feature; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22494.3	downstream_gene_variant ; 1890.0bp to feature; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N
vg0712651082	C -> A	LOC_Os07g22480-LOC_Os07g22494	intergenic_region ; MODIFIER	silent_mutation	Average:14.304; most accessible tissue: Callus, score: 26.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712651082	NA	7.40E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082	4.17E-06	3.35E-08	mr1538_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082	NA	6.62E-07	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712651082	7.46E-06	7.41E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251