\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712648528:

Variant ID: vg0712648528 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12648528
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGTTCGGCCGAACCACAATCTCAGCCATCCAGGCTGGGGTTTGGCGTGGACGCTCCAGATCACTCCCTAATGGCGGTTGTGGGGCATTTCGGACATTT[T/C]
CCCTTCGCCAACCGTCATACCTACCTCTATATAAAGACATCACTCCCTCACTTCACACACACATTTCCAAGCTTGAGCTGAATTATAAGAGGCTCTATTG

Reverse complement sequence

CAATAGAGCCTCTTATAATTCAGCTCAAGCTTGGAAATGTGTGTGTGAAGTGAGGGAGTGATGTCTTTATATAGAGGTAGGTATGACGGTTGGCGAAGGG[A/G]
AAATGTCCGAAATGCCCCACAACCGCCATTAGGGAGTGATCTGGAGCGTCCACGCCAAACCCCAGCCTGGATGGCTGAGATTGTGGTTCGGCCGAACCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.50% 15.60% 13.67% 38.24% NA
All Indica  2759 7.30% 11.90% 20.59% 60.24% NA
All Japonica  1512 78.80% 19.50% 0.13% 1.52% NA
Aus  269 33.50% 9.30% 24.91% 32.34% NA
Indica I  595 2.40% 1.00% 7.56% 89.08% NA
Indica II  465 9.00% 9.50% 22.37% 59.14% NA
Indica III  913 8.10% 18.60% 30.67% 42.61% NA
Indica Intermediate  786 9.20% 13.60% 17.68% 59.54% NA
Temperate Japonica  767 65.40% 33.00% 0.00% 1.56% NA
Tropical Japonica  504 98.60% 0.60% 0.20% 0.60% NA
Japonica Intermediate  241 80.10% 16.20% 0.41% 3.32% NA
VI/Aromatic  96 6.20% 80.20% 3.12% 10.42% NA
Intermediate  90 52.20% 13.30% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712648528 T -> DEL N N silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22480.1 downstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22494.1 downstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22494.4 downstream_gene_variant ; 4388.0bp to feature; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22494.2 downstream_gene_variant ; 4439.0bp to feature; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22494.3 downstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0712648528 T -> C LOC_Os07g22480-LOC_Os07g22494 intergenic_region ; MODIFIER silent_mutation Average:12.01; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712648528 NA 6.42E-21 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0712648528 1.10E-07 1.10E-07 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 3.14E-06 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 4.01E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 3.15E-09 mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 1.08E-07 1.08E-07 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 7.29E-06 7.29E-06 mr1331 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 7.56E-07 1.05E-07 mr1372 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 2.65E-06 2.65E-06 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 1.59E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 2.64E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 1.06E-06 5.02E-07 mr1433 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 6.97E-06 6.97E-06 mr1462 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 3.69E-07 3.69E-07 mr1474 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 3.69E-07 3.69E-07 mr1475 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 9.58E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 2.11E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 8.79E-06 8.79E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 4.70E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 1.24E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 2.02E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 2.48E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 8.03E-06 8.03E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 5.15E-06 5.15E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 6.75E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 3.17E-07 3.17E-07 mr1972 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 9.08E-09 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 2.33E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712648528 NA 5.73E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251