Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712602607:

Variant ID: vg0712602607 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12602607
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGCCAACGACGCTGAGGCTTGGTTGGTGATAGTCTTGAGATCGGAGAGGGAGGACTCGGCTGCCAGTCGGCGTGCGGGTGCTTGCGGAGTTAGCCGGGA[T/C]
CGAGGCGGCGATCATGGTCTTCGTCTGATTCAAGATGTTGACGACATGATCGGCCTGATTGAGCGCATCTTCCTTGAGGAGGGTGTCGAGGAGGGTGATC

Reverse complement sequence

GATCACCCTCCTCGACACCCTCCTCAAGGAAGATGCGCTCAATCAGGCCGATCATGTCGTCAACATCTTGAATCAGACGAAGACCATGATCGCCGCCTCG[A/G]
TCCCGGCTAACTCCGCAAGCACCCGCACGCCGACTGGCAGCCGAGTCCTCCCTCTCCGATCTCAAGACTATCACCAACCAAGCCTCAGCGTCGTTGGCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	28.70%	11.47%	6.39%	NA
All Indica	2759	81.80%	6.20%	9.39%	2.65%	NA
All Japonica	1512	2.10%	75.60%	8.00%	14.35%	NA
Aus	269	65.40%	3.00%	30.86%	0.74%	NA
Indica I	595	86.70%	10.80%	2.35%	0.17%	NA
Indica II	465	80.60%	6.50%	8.60%	4.30%	NA
Indica III	913	84.10%	2.70%	10.51%	2.63%	NA
Indica Intermediate	786	76.10%	6.50%	13.87%	3.56%	NA
Temperate Japonica	767	2.10%	67.30%	5.22%	25.42%	NA
Tropical Japonica	504	0.80%	86.10%	12.90%	0.20%	NA
Japonica Intermediate	241	4.60%	80.10%	6.64%	8.71%	NA
VI/Aromatic	96	22.90%	0.00%	66.67%	10.42%	NA
Intermediate	90	44.40%	38.90%	16.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712602607	T -> DEL	LOC_Os07g22420.1	N	frameshift_variant	Average:56.717; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg0712602607	T -> C	LOC_Os07g22420.1	missense_variant ; p.Ile322Val; MODERATE	nonsynonymous_codon ; I322A	Average:56.717; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	benign	0.882	DELETERIOUS	0.00
vg0712602607	T -> C	LOC_Os07g22420.1	missense_variant ; p.Ile322Val; MODERATE	nonsynonymous_codon ; I322V	Average:56.717; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	benign	-0.344	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712602607	NA	1.22E-19	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	2.25E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	1.03E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	2.36E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	7.68E-11	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	1.08E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	9.92E-07	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	5.91E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	1.45E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	2.02E-07	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	2.30E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	4.48E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	8.18E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	2.00E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	1.32E-06	mr1726_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	6.02E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712602607	NA	3.53E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251