Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0712529793:

Variant ID: vg0712529793 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12529793
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAAAGGAGATATTTATACCCCAAACCCAATCTTTCTTACCCTTCATTGCTTTCTTGTTATTTTGTGACTTTTATTGAATTTGGTTCTTTCTCTTCTT[T/A]
AGTAGAGTCTATTTTGGATGGCAGCATGTGATATTTCGAGGATCGGATAATCAAGTTACCTATCATGGATTTATTTGCGTTGGAGCAAGGCAAGTTATTA

Reverse complement sequence

TAATAACTTGCCTTGCTCCAACGCAAATAAATCCATGATAGGTAACTTGATTATCCGATCCTCGAAATATCACATGCTGCCATCCAAAATAGACTCTACT[A/T]
AAGAAGAGAAAGAACCAAATTCAATAAAAGTCACAAAATAACAAGAAAGCAATGAAGGGTAAGAAAGATTGGGTTTGGGGTATAAATATCTCCTTTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	0.00%	0.44%	1.74%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	93.50%	0.00%	1.26%	5.22%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	91.10%	0.00%	0.91%	7.95%	NA
Tropical Japonica	504	97.20%	0.00%	1.39%	1.39%	NA
Japonica Intermediate	241	93.40%	0.00%	2.07%	4.56%	NA
VI/Aromatic	96	96.90%	1.00%	2.08%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712529793	T -> DEL	N	N	silent_mutation	Average:35.092; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N
vg0712529793	T -> A	LOC_Os07g22330.1	upstream_gene_variant ; 594.0bp to feature; MODIFIER	silent_mutation	Average:35.092; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N
vg0712529793	T -> A	LOC_Os07g22330-LOC_Os07g22340	intergenic_region ; MODIFIER	silent_mutation	Average:35.092; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712529793	3.33E-06	6.90E-08	mr1693_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251