\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712512342:

Variant ID: vg0712512342 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12512342
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCAACGAAACACAGTCGGACTCGAACCTGCCGGTCAGACCGGCCACACACCGCCGGTCTGACCGGCCCTCAACCGGCGGTCTGACCGCCCAACACACGG[T/C]
GGTCAGACCGGCCCACTCGGAGGAAACCAGTAGACTTCCAAACTTTTACAATATTTCCTATTGTAATCCTAGGCGCCAAATTTGGGTGTAAACAGTTACC

Reverse complement sequence

GGTAACTGTTTACACCCAAATTTGGCGCCTAGGATTACAATAGGAAATATTGTAAAAGTTTGGAAGTCTACTGGTTTCCTCCGAGTGGGCCGGTCTGACC[A/G]
CCGTGTGTTGGGCGGTCAGACCGCCGGTTGAGGGCCGGTCAGACCGGCGGTGTGTGGCCGGTCTGACCGGCAGGTTCGAGTCCGACTGTGTTTCGTTGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 25.70% 0.19% 9.10% NA
All Indica  2759 95.90% 2.10% 0.11% 1.92% NA
All Japonica  1512 6.30% 74.30% 0.26% 19.05% NA
Aus  269 95.20% 0.00% 0.00% 4.83% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.80% 0.80% 0.33% 0.11% NA
Indica Intermediate  786 91.10% 2.30% 0.00% 6.62% NA
Temperate Japonica  767 2.00% 65.40% 0.52% 32.07% NA
Tropical Japonica  504 13.70% 85.70% 0.00% 0.60% NA
Japonica Intermediate  241 5.00% 78.80% 0.00% 16.18% NA
VI/Aromatic  96 24.00% 0.00% 1.04% 75.00% NA
Intermediate  90 57.80% 36.70% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712512342 T -> DEL N N silent_mutation Average:56.051; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0712512342 T -> C LOC_Os07g22310.1 upstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:56.051; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0712512342 T -> C LOC_Os07g22320.1 downstream_gene_variant ; 822.0bp to feature; MODIFIER silent_mutation Average:56.051; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N
vg0712512342 T -> C LOC_Os07g22310-LOC_Os07g22320 intergenic_region ; MODIFIER silent_mutation Average:56.051; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712512342 NA 5.53E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712512342 NA 4.72E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712512342 NA 1.85E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712512342 4.45E-06 NA mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251