\
| Variant ID: vg0712460832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12460832 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATGGATTTTCTTGTATTTCAAATAAGGATATATTAGTTTGGATCTTTTCACCTTTTAACAATTGTATAATTAGCTTGTATAACCAAATTTGTATAATTA[A/C]
TCGAAAGCTGTTCTGTATATCAATTTGTACGTGATCGAAATCCTAGACGATCACGAGTGGATTTTCGGGGCACCAAGCCTAAATTGGGTGTCCCACATTG
CAATGTGGGACACCCAATTTAGGCTTGGTGCCCCGAAAATCCACTCGTGATCGTCTAGGATTTCGATCACGTACAAATTGATATACAGAACAGCTTTCGA[T/G]
TAATTATACAAATTTGGTTATACAAGCTAATTATACAATTGTTAAAAGGTGAAAAGATCCAAACTAATATATCCTTATTTGAAATACAAGAAAATCCATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.50% | 0.20% | 3.79% | 53.49% | NA |
| All Indica | 2759 | 15.10% | 0.30% | 4.93% | 79.70% | NA |
| All Japonica | 1512 | 88.50% | 0.00% | 1.59% | 9.92% | NA |
| Aus | 269 | 46.50% | 0.40% | 5.20% | 47.96% | NA |
| Indica I | 595 | 9.10% | 0.00% | 4.54% | 86.39% | NA |
| Indica II | 465 | 11.40% | 0.00% | 3.87% | 84.73% | NA |
| Indica III | 913 | 17.90% | 0.50% | 5.26% | 76.34% | NA |
| Indica Intermediate | 786 | 18.60% | 0.40% | 5.47% | 75.57% | NA |
| Temperate Japonica | 767 | 81.40% | 0.00% | 2.61% | 16.04% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 88.80% | 0.00% | 1.66% | 9.54% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 2.08% | 14.58% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 3.33% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712460832 | A -> DEL | N | N | silent_mutation | Average:7.796; most accessible tissue: Callus, score: 19.615 | N | N | N | N |
| vg0712460832 | A -> C | LOC_Os07g22250.1 | upstream_gene_variant ; 3648.0bp to feature; MODIFIER | silent_mutation | Average:7.796; most accessible tissue: Callus, score: 19.615 | N | N | N | N |
| vg0712460832 | A -> C | LOC_Os07g22240-LOC_Os07g22250 | intergenic_region ; MODIFIER | silent_mutation | Average:7.796; most accessible tissue: Callus, score: 19.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712460832 | 4.62E-06 | NA | mr1187_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712460832 | 1.08E-07 | 1.08E-07 | mr1187_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712460832 | NA | 1.89E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |