RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0712460832:

Variant ID: vg0712460832 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12460832
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGGATTTTCTTGTATTTCAAATAAGGATATATTAGTTTGGATCTTTTCACCTTTTAACAATTGTATAATTAGCTTGTATAACCAAATTTGTATAATTA[A/C]
TCGAAAGCTGTTCTGTATATCAATTTGTACGTGATCGAAATCCTAGACGATCACGAGTGGATTTTCGGGGCACCAAGCCTAAATTGGGTGTCCCACATTG

Reverse complement sequence

CAATGTGGGACACCCAATTTAGGCTTGGTGCCCCGAAAATCCACTCGTGATCGTCTAGGATTTCGATCACGTACAAATTGATATACAGAACAGCTTTCGA[T/G]
TAATTATACAAATTTGGTTATACAAGCTAATTATACAATTGTTAAAAGGTGAAAAGATCCAAACTAATATATCCTTATTTGAAATACAAGAAAATCCATA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.50%	0.20%	3.79%	53.49%	NA
All Indica	2759	15.10%	0.30%	4.93%	79.70%	NA
All Japonica	1512	88.50%	0.00%	1.59%	9.92%	NA
Aus	269	46.50%	0.40%	5.20%	47.96%	NA
Indica I	595	9.10%	0.00%	4.54%	86.39%	NA
Indica II	465	11.40%	0.00%	3.87%	84.73%	NA
Indica III	913	17.90%	0.50%	5.26%	76.34%	NA
Indica Intermediate	786	18.60%	0.40%	5.47%	75.57%	NA
Temperate Japonica	767	81.40%	0.00%	2.61%	16.04%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	88.80%	0.00%	1.66%	9.54%	NA
VI/Aromatic	96	83.30%	0.00%	2.08%	14.58%	NA
Intermediate	90	56.70%	0.00%	3.33%	40.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712460832	A -> DEL	N	N	silent_mutation	Average:7.796; most accessible tissue: Callus, score: 19.615	N	N	N	N
vg0712460832	A -> C	LOC_Os07g22250.1	upstream_gene_variant ; 3648.0bp to feature; MODIFIER	silent_mutation	Average:7.796; most accessible tissue: Callus, score: 19.615	N	N	N	N
vg0712460832	A -> C	LOC_Os07g22240-LOC_Os07g22250	intergenic_region ; MODIFIER	silent_mutation	Average:7.796; most accessible tissue: Callus, score: 19.615	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712460832	4.62E-06	NA	mr1187_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712460832	1.08E-07	1.08E-07	mr1187_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712460832	NA	1.89E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0712460832:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact