\
| Variant ID: vg0712408577 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12408577 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTGAACAACCTTGCAAGAACTGACCTTGTAAACCATAACCACTATAGGTAGCACTTGTTGCCTCTGGGATTGGGGGTGACTTAGCTGTGCTGGTCTGCT[A/G]
AAGACTTGGTGGCGTACTGTCTGAGGTTGCAGGTGCTTGCTCTTGGAAAACAAACTGACTTTCGCTCTGATCCTGATTCCGGCTTGCATCTGAGCTTGTA
TACAAGCTCAGATGCAAGCCGGAATCAGGATCAGAGCGAAAGTCAGTTTGTTTTCCAAGAGCAAGCACCTGCAACCTCAGACAGTACGCCACCAAGTCTT[T/C]
AGCAGACCAGCACAGCTAAGTCACCCCCAATCCCAGAGGCAACAAGTGCTACCTATAGTGGTTATGGTTTACAAGGTCAGTTCTTGCAAGGTTGTTCAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.40% | 8.70% | 19.32% | 45.58% | NA |
| All Indica | 2759 | 2.30% | 9.60% | 18.88% | 69.19% | NA |
| All Japonica | 1512 | 75.50% | 7.50% | 7.14% | 9.85% | NA |
| Aus | 269 | 1.90% | 9.70% | 61.71% | 26.77% | NA |
| Indica I | 595 | 2.00% | 6.20% | 17.14% | 74.62% | NA |
| Indica II | 465 | 3.90% | 7.30% | 16.34% | 72.47% | NA |
| Indica III | 913 | 1.80% | 12.70% | 14.13% | 71.41% | NA |
| Indica Intermediate | 786 | 2.30% | 9.90% | 27.23% | 60.56% | NA |
| Temperate Japonica | 767 | 67.50% | 10.30% | 5.74% | 16.43% | NA |
| Tropical Japonica | 504 | 86.10% | 3.40% | 9.92% | 0.60% | NA |
| Japonica Intermediate | 241 | 78.80% | 7.10% | 5.81% | 8.30% | NA |
| VI/Aromatic | 96 | 0.00% | 4.20% | 95.83% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 5.60% | 28.89% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712408577 | A -> DEL | N | N | silent_mutation | Average:39.551; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg0712408577 | A -> G | LOC_Os07g22210-LOC_Os07g22220 | intergenic_region ; MODIFIER | silent_mutation | Average:39.551; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712408577 | NA | 3.72E-20 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.30E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 9.82E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | 2.02E-06 | 1.46E-25 | mr1042_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.71E-20 | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 7.84E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.17E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.98E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 4.63E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 5.14E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 6.85E-13 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.22E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 2.55E-11 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 9.39E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 1.80E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 9.88E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 2.91E-17 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 2.89E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 4.84E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712408577 | NA | 8.61E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |