\
| Variant ID: vg0712392714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12392714 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.28, others allele: 0.00, population size: 218. )
GGCAACCTGGATTTGCTGTCTAAAGACCTTACAATCATTGGTAGAATGAGACCTGGAATTATGCCATTTGCAATATCTCTTCTTGCCTAATTCCTCAGCC[G/A]
ATGGGATCGTATGACCAGCAGGAAGCTGAATCTGCTTTTCTCGGAGTAGCAAATCGAAAATCTTGTCAGCTTTGGTGATATCAAAATCATACTTCTCCTC
GAGGAGAAGTATGATTTTGATATCACCAAAGCTGACAAGATTTTCGATTTGCTACTCCGAGAAAAGCAGATTCAGCTTCCTGCTGGTCATACGATCCCAT[C/T]
GGCTGAGGAATTAGGCAAGAAGAGATATTGCAAATGGCATAATTCCAGGTCTCATTCTACCAATGATTGTAAGGTCTTTAGACAGCAAATCCAGGTTGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 35.20% | 7.24% | 5.95% | NA |
| All Indica | 2759 | 76.80% | 3.10% | 11.31% | 8.84% | NA |
| All Japonica | 1512 | 6.10% | 93.70% | 0.13% | 0.07% | NA |
| Aus | 269 | 60.20% | 20.40% | 8.55% | 10.78% | NA |
| Indica I | 595 | 85.40% | 0.30% | 9.24% | 5.04% | NA |
| Indica II | 465 | 79.80% | 3.20% | 10.54% | 6.45% | NA |
| Indica III | 913 | 70.40% | 0.30% | 15.22% | 14.02% | NA |
| Indica Intermediate | 786 | 75.80% | 8.30% | 8.78% | 7.12% | NA |
| Temperate Japonica | 767 | 1.80% | 97.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 13.10% | 86.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 72.90% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 47.80% | 42.20% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712392714 | G -> DEL | LOC_Os07g22200.1 | N | frameshift_variant | Average:45.579; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0712392714 | G -> A | LOC_Os07g22200.1 | missense_variant ; p.Ser608Leu; MODERATE | nonsynonymous_codon ; S608L | Average:45.579; most accessible tissue: Minghui63 flag leaf, score: 68.16 | benign |
1.033 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712392714 | NA | 2.45E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | 9.90E-07 | 6.05E-06 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 5.62E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | 5.05E-08 | NA | mr1150_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | 6.08E-08 | 3.64E-06 | mr1150_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 6.41E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 1.37E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 1.31E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 8.91E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 5.65E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 1.31E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 1.45E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 1.97E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | NA | 5.15E-11 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712392714 | 9.94E-06 | 4.21E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |