RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0712392714:

Variant ID: vg0712392714 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12392714
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.28, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAACCTGGATTTGCTGTCTAAAGACCTTACAATCATTGGTAGAATGAGACCTGGAATTATGCCATTTGCAATATCTCTTCTTGCCTAATTCCTCAGCC[G/A]
ATGGGATCGTATGACCAGCAGGAAGCTGAATCTGCTTTTCTCGGAGTAGCAAATCGAAAATCTTGTCAGCTTTGGTGATATCAAAATCATACTTCTCCTC

Reverse complement sequence

GAGGAGAAGTATGATTTTGATATCACCAAAGCTGACAAGATTTTCGATTTGCTACTCCGAGAAAAGCAGATTCAGCTTCCTGCTGGTCATACGATCCCAT[C/T]
GGCTGAGGAATTAGGCAAGAAGAGATATTGCAAATGGCATAATTCCAGGTCTCATTCTACCAATGATTGTAAGGTCTTTAGACAGCAAATCCAGGTTGCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.60%	35.20%	7.24%	5.95%	NA
All Indica	2759	76.80%	3.10%	11.31%	8.84%	NA
All Japonica	1512	6.10%	93.70%	0.13%	0.07%	NA
Aus	269	60.20%	20.40%	8.55%	10.78%	NA
Indica I	595	85.40%	0.30%	9.24%	5.04%	NA
Indica II	465	79.80%	3.20%	10.54%	6.45%	NA
Indica III	913	70.40%	0.30%	15.22%	14.02%	NA
Indica Intermediate	786	75.80%	8.30%	8.78%	7.12%	NA
Temperate Japonica	767	1.80%	97.90%	0.26%	0.00%	NA
Tropical Japonica	504	13.10%	86.70%	0.00%	0.20%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	72.90%	2.08%	1.04%	NA
Intermediate	90	47.80%	42.20%	3.33%	6.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712392714	G -> DEL	LOC_Os07g22200.1	N	frameshift_variant	Average:45.579; most accessible tissue: Minghui63 flag leaf, score: 68.16	N	N	N	N
vg0712392714	G -> A	LOC_Os07g22200.1	missense_variant ; p.Ser608Leu; MODERATE	nonsynonymous_codon ; S608L	Average:45.579; most accessible tissue: Minghui63 flag leaf, score: 68.16	benign	1.033	DELETERIOUS	0.03

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712392714	NA	2.45E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	9.90E-07	6.05E-06	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	5.62E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	5.05E-08	NA	mr1150_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	6.08E-08	3.64E-06	mr1150_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	6.41E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	1.37E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	1.31E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	8.91E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712392714	NA	5.65E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 15 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0712392714:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact