\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712288904:

Variant ID: vg0712288904 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12288904
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGCTTGAGGTGTGTGAAGAAATGGAGAGAGTGAGAGGTTTATATAGCTTGAGAATGATAGTTATGATGGTTGGAAAGGTCAATGATACCCACCAACC[G/A]
TCATTGGGGAGTCATCTTAGCCGTCTCTCCAATCCTGGATTAAACGGGGTTCGGCCGAACCTGGGGCTGGCCCAACCTGCCCACAGTTCAGCTGGCGGCC

Reverse complement sequence

GGCCGCCAGCTGAACTGTGGGCAGGTTGGGCCAGCCCCAGGTTCGGCCGAACCCCGTTTAATCCAGGATTGGAGAGACGGCTAAGATGACTCCCCAATGA[C/T]
GGTTGGTGGGTATCATTGACCTTTCCAACCATCATAACTATCATTCTCAAGCTATATAAACCTCTCACTCTCTCCATTTCTTCACACACCTCAAGCAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 7.60% 0.55% 0.06% NA
All Indica  2759 99.50% 0.00% 0.40% 0.07% NA
All Japonica  1512 76.00% 23.10% 0.79% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.00% 1.40% 0.25% NA
Temperate Japonica  767 98.80% 0.30% 0.78% 0.13% NA
Tropical Japonica  504 32.10% 66.90% 0.99% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712288904 G -> DEL N N silent_mutation Average:54.75; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0712288904 G -> A LOC_Os07g21960.1 downstream_gene_variant ; 4208.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0712288904 G -> A LOC_Os07g21970.1 downstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0712288904 G -> A LOC_Os07g21980.1 downstream_gene_variant ; 3281.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg0712288904 G -> A LOC_Os07g21960-LOC_Os07g21970 intergenic_region ; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712288904 NA 4.79E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 9.06E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 3.50E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 3.23E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 1.82E-09 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 1.11E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 1.37E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 1.66E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 5.86E-09 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 7.91E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 7.04E-06 1.56E-10 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 5.61E-09 mr1363_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 9.57E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 7.22E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 1.42E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 6.11E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 3.37E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 4.52E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 9.58E-16 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712288904 NA 6.46E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251