Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712115727:

Variant ID: vg0712115727 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12115727
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCCAAAAATCAAGTTTTGGTGCTTTTTGAACTTTTTCAGTCAAAAACATCGCACCCACGTCGGCCAATATATGCTAATATTGGCATTAATTGACAAAA[G/C,T]
TTCACTGTGTGAATCACGAAGTAAGTTTTTGCCACGAACGCACCCAATACACTCCAATATGTCAAAAAGATCATATTATGGTGCTTTTCGAACTTTTTCA

Reverse complement sequence

TGAAAAAGTTCGAAAAGCACCATAATATGATCTTTTTGACATATTGGAGTGTATTGGGTGCGTTCGTGGCAAAAACTTACTTCGTGATTCACACAGTGAA[C/G,A]
TTTTGTCAATTAATGCCAATATTAGCATATATTGGCCGACGTGGGTGCGATGTTTTTGACTGAAAAAGTTCAAAAAGCACCAAAACTTGATTTTTGGACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	37.20%	0.25%	1.08%	T: 0.06%
All Indica	2759	93.20%	5.70%	0.22%	0.83%	T: 0.11%
All Japonica	1512	6.90%	93.10%	0.00%	0.00%	NA
Aus	269	57.20%	30.10%	2.23%	10.41%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	92.00%	7.10%	0.43%	0.43%	NA
Indica III	913	95.90%	2.70%	0.11%	1.20%	NA
Indica Intermediate	786	86.50%	11.50%	0.38%	1.27%	T: 0.38%
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	13.50%	86.50%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712115727	G -> DEL	N	N	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> T	LOC_Os07g20950.1	upstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> T	LOC_Os07g20940.1	downstream_gene_variant ; 2055.0bp to feature; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> T	LOC_Os07g20940-LOC_Os07g20950	intergenic_region ; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> C	LOC_Os07g20950.1	upstream_gene_variant ; 2051.0bp to feature; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> C	LOC_Os07g20940.1	downstream_gene_variant ; 2055.0bp to feature; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0712115727	G -> C	LOC_Os07g20940-LOC_Os07g20950	intergenic_region ; MODIFIER	silent_mutation	Average:37.304; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712115727	3.21E-08	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0712115727	NA	3.84E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0712115727	NA	6.86E-07	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	2.75E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	6.70E-06	5.82E-08	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	5.35E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	2.81E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	9.93E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	2.07E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	8.38E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	1.33E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	4.83E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	8.86E-60	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	9.67E-08	6.21E-09	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	3.57E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	1.12E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	1.47E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	2.16E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	1.41E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115727	NA	6.66E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251