\
| Variant ID: vg0712115543 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 12115543 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCACCCAATACACTCTAATATGTCCAAAAATCATATTTTTGTGCTTTTTGAACATTTTCGTTCCGGTCAAAAACATCGTACCCATGTGGGCAATATATGC[C/T]
AATGTTGGTATTAATTGACAAAAGTTCACCGTGCGAATCACGAAGTGAGTTTTTGCCACGAACGCATCCAATACACCTCAATATGTCCAAAAATCAAGTT
AACTTGATTTTTGGACATATTGAGGTGTATTGGATGCGTTCGTGGCAAAAACTCACTTCGTGATTCGCACGGTGAACTTTTGTCAATTAATACCAACATT[G/A]
GCATATATTGCCCACATGGGTACGATGTTTTTGACCGGAACGAAAATGTTCAAAAAGCACAAAAATATGATTTTTGGACATATTAGAGTGTATTGGGTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 34.00% | 3.09% | 1.31% | NA |
| All Indica | 2759 | 93.30% | 4.50% | 1.16% | 1.09% | NA |
| All Japonica | 1512 | 7.10% | 87.20% | 5.62% | 0.00% | NA |
| Aus | 269 | 57.20% | 28.60% | 2.60% | 11.52% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.30% | 5.80% | 0.86% | 1.08% | NA |
| Indica III | 913 | 95.90% | 2.00% | 0.77% | 1.31% | NA |
| Indica Intermediate | 786 | 86.90% | 8.90% | 2.54% | 1.65% | NA |
| Temperate Japonica | 767 | 3.10% | 88.10% | 8.74% | 0.00% | NA |
| Tropical Japonica | 504 | 13.90% | 85.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 87.60% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 49.00% | 21.88% | 1.04% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0712115543 | C -> DEL | N | N | silent_mutation | Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0712115543 | C -> T | LOC_Os07g20950.1 | upstream_gene_variant ; 2235.0bp to feature; MODIFIER | silent_mutation | Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0712115543 | C -> T | LOC_Os07g20940.1 | downstream_gene_variant ; 1871.0bp to feature; MODIFIER | silent_mutation | Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0712115543 | C -> T | LOC_Os07g20940-LOC_Os07g20950 | intergenic_region ; MODIFIER | silent_mutation | Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0712115543 | 5.59E-06 | 3.24E-07 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | NA | 7.30E-06 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | 7.37E-07 | 2.29E-08 | mr1504 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | NA | 2.53E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | NA | 1.17E-58 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | 7.41E-08 | 1.40E-08 | mr1962 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0712115543 | NA | 1.48E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |