Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712115543:

Variant ID: vg0712115543 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12115543
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCACCCAATACACTCTAATATGTCCAAAAATCATATTTTTGTGCTTTTTGAACATTTTCGTTCCGGTCAAAAACATCGTACCCATGTGGGCAATATATGC[C/T]
AATGTTGGTATTAATTGACAAAAGTTCACCGTGCGAATCACGAAGTGAGTTTTTGCCACGAACGCATCCAATACACCTCAATATGTCCAAAAATCAAGTT

Reverse complement sequence

AACTTGATTTTTGGACATATTGAGGTGTATTGGATGCGTTCGTGGCAAAAACTCACTTCGTGATTCGCACGGTGAACTTTTGTCAATTAATACCAACATT[G/A]
GCATATATTGCCCACATGGGTACGATGTTTTTGACCGGAACGAAAATGTTCAAAAAGCACAAAAATATGATTTTTGGACATATTAGAGTGTATTGGGTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	34.00%	3.09%	1.31%	NA
All Indica	2759	93.30%	4.50%	1.16%	1.09%	NA
All Japonica	1512	7.10%	87.20%	5.62%	0.00%	NA
Aus	269	57.20%	28.60%	2.60%	11.52%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	92.30%	5.80%	0.86%	1.08%	NA
Indica III	913	95.90%	2.00%	0.77%	1.31%	NA
Indica Intermediate	786	86.90%	8.90%	2.54%	1.65%	NA
Temperate Japonica	767	3.10%	88.10%	8.74%	0.00%	NA
Tropical Japonica	504	13.90%	85.70%	0.40%	0.00%	NA
Japonica Intermediate	241	5.80%	87.60%	6.64%	0.00%	NA
VI/Aromatic	96	28.10%	49.00%	21.88%	1.04%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712115543	C -> DEL	N	N	silent_mutation	Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0712115543	C -> T	LOC_Os07g20950.1	upstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0712115543	C -> T	LOC_Os07g20940.1	downstream_gene_variant ; 1871.0bp to feature; MODIFIER	silent_mutation	Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0712115543	C -> T	LOC_Os07g20940-LOC_Os07g20950	intergenic_region ; MODIFIER	silent_mutation	Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712115543	5.59E-06	3.24E-07	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	NA	7.30E-06	mr1135	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	7.37E-07	2.29E-08	mr1504	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	NA	2.53E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	NA	1.17E-58	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	7.41E-08	1.40E-08	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543	NA	1.48E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251