\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712115543:

Variant ID: vg0712115543 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12115543
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACCCAATACACTCTAATATGTCCAAAAATCATATTTTTGTGCTTTTTGAACATTTTCGTTCCGGTCAAAAACATCGTACCCATGTGGGCAATATATGC[C/T]
AATGTTGGTATTAATTGACAAAAGTTCACCGTGCGAATCACGAAGTGAGTTTTTGCCACGAACGCATCCAATACACCTCAATATGTCCAAAAATCAAGTT

Reverse complement sequence

AACTTGATTTTTGGACATATTGAGGTGTATTGGATGCGTTCGTGGCAAAAACTCACTTCGTGATTCGCACGGTGAACTTTTGTCAATTAATACCAACATT[G/A]
GCATATATTGCCCACATGGGTACGATGTTTTTGACCGGAACGAAAATGTTCAAAAAGCACAAAAATATGATTTTTGGACATATTAGAGTGTATTGGGTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 34.00% 3.09% 1.31% NA
All Indica  2759 93.30% 4.50% 1.16% 1.09% NA
All Japonica  1512 7.10% 87.20% 5.62% 0.00% NA
Aus  269 57.20% 28.60% 2.60% 11.52% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 92.30% 5.80% 0.86% 1.08% NA
Indica III  913 95.90% 2.00% 0.77% 1.31% NA
Indica Intermediate  786 86.90% 8.90% 2.54% 1.65% NA
Temperate Japonica  767 3.10% 88.10% 8.74% 0.00% NA
Tropical Japonica  504 13.90% 85.70% 0.40% 0.00% NA
Japonica Intermediate  241 5.80% 87.60% 6.64% 0.00% NA
VI/Aromatic  96 28.10% 49.00% 21.88% 1.04% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712115543 C -> DEL N N silent_mutation Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0712115543 C -> T LOC_Os07g20950.1 upstream_gene_variant ; 2235.0bp to feature; MODIFIER silent_mutation Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0712115543 C -> T LOC_Os07g20940.1 downstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0712115543 C -> T LOC_Os07g20940-LOC_Os07g20950 intergenic_region ; MODIFIER silent_mutation Average:39.482; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712115543 5.59E-06 3.24E-07 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 NA 7.30E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 7.37E-07 2.29E-08 mr1504 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 NA 2.53E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 NA 1.17E-58 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 7.41E-08 1.40E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712115543 NA 1.48E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251