\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712111505:

Variant ID: vg0712111505 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12111505
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTATGTCACCATTCCACTTGCTTTGGTAAGAACTTGTAAGAGCTTGGTTAAAGGATTGAGTGTGTGTGATATTTGAGCTGCCACTACCTAGTAGTTGA[T/A]
AGGAGCGTGCATATTCTTGTGTGTGTTTCTTGTTTGCTACTAACCATGGCAGGATTGCGCAAGGGAATACGAGAACATCGGCTTCTTCACCGTCTACAAG

Reverse complement sequence

CTTGTAGACGGTGAAGAAGCCGATGTTCTCGTATTCCCTTGCGCAATCCTGCCATGGTTAGTAGCAAACAAGAAACACACACAAGAATATGCACGCTCCT[A/T]
TCAACTACTAGGTAGTGGCAGCTCAAATATCACACACACTCAATCCTTTAACCAAGCTCTTACAAGTTCTTACCAAAGCAAGTGGAATGGTGACATACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 4.60% 8.80% 8.99% NA
All Indica  2759 70.90% 3.10% 13.05% 12.94% NA
All Japonica  1512 92.90% 3.80% 0.99% 2.25% NA
Aus  269 61.70% 26.40% 7.43% 4.46% NA
Indica I  595 84.00% 0.20% 7.56% 8.24% NA
Indica II  465 77.60% 2.40% 13.76% 6.24% NA
Indica III  913 57.70% 3.90% 16.32% 22.02% NA
Indica Intermediate  786 72.30% 4.80% 12.98% 9.92% NA
Temperate Japonica  767 88.80% 6.90% 1.30% 3.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 91.70% 2.10% 1.66% 4.56% NA
VI/Aromatic  96 60.40% 2.10% 18.75% 18.75% NA
Intermediate  90 91.10% 1.10% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712111505 T -> DEL N N silent_mutation Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0712111505 T -> A LOC_Os07g20940.1 upstream_gene_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0712111505 T -> A LOC_Os07g20930.1 downstream_gene_variant ; 1441.0bp to feature; MODIFIER silent_mutation Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0712111505 T -> A LOC_Os07g20930-LOC_Os07g20940 intergenic_region ; MODIFIER silent_mutation Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712111505 NA 4.14E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712111505 NA 2.99E-08 mr1167_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712111505 NA 1.79E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251