\
| Variant ID: vg0711956562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11956562 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCATTAGCGACTTTGTCCCTAGCCCCTTCAAGCCTATTGATCTTGTCAACTAAGACATCAAACTGTGCCTGGGACTTGATCTTGCGGTCTGCATTAACA[G/T]
ATTCACATTAATGAATCAGCATATAGAAGATAATGGCTTTTGAGGTATTGATTATTGGTACCTTCAACATCCTTTAAAGCTGAGTCCCTCTGTCTTTCCA
TGGAAAGACAGAGGGACTCAGCTTTAAAGGATGTTGAAGGTACCAATAATCAATACCTCAAAAGCCATTATCTTCTATATGCTGATTCATTAATGTGAAT[C/A]
TGTTAATGCAGACCGCAAGATCAAGTCCCAGGCACAGTTTGATGTCTTAGTTGACAAGATCAATAGGCTTGAAGGGGCTAGGGACAAAGTCGCTAATGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 0.10% | 6.60% | 1.16% | NA |
| All Indica | 2759 | 98.40% | 0.00% | 1.52% | 0.11% | NA |
| All Japonica | 1512 | 83.60% | 0.40% | 12.76% | 3.24% | NA |
| Aus | 269 | 95.50% | 0.00% | 4.46% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 0.00% | 5.22% | 0.38% | NA |
| Temperate Japonica | 767 | 72.80% | 0.70% | 20.60% | 6.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 0.40% | 13.28% | 1.24% | NA |
| VI/Aromatic | 96 | 33.30% | 0.00% | 63.54% | 3.12% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711956562 | G -> DEL | N | N | silent_mutation | Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0711956562 | G -> T | LOC_Os07g20680.1 | downstream_gene_variant ; 2321.0bp to feature; MODIFIER | silent_mutation | Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0711956562 | G -> T | LOC_Os07g20690.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711956562 | 3.08E-06 | 3.08E-06 | mr1166 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | 2.10E-06 | 1.87E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | 2.19E-06 | 3.82E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | 6.57E-07 | 6.57E-07 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | 2.87E-06 | 9.87E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | NA | 2.23E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | 6.52E-08 | 3.03E-08 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | NA | 7.97E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | NA | 1.39E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711956562 | NA | 3.56E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |