\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711956562:

Variant ID: vg0711956562 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11956562
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCATTAGCGACTTTGTCCCTAGCCCCTTCAAGCCTATTGATCTTGTCAACTAAGACATCAAACTGTGCCTGGGACTTGATCTTGCGGTCTGCATTAACA[G/T]
ATTCACATTAATGAATCAGCATATAGAAGATAATGGCTTTTGAGGTATTGATTATTGGTACCTTCAACATCCTTTAAAGCTGAGTCCCTCTGTCTTTCCA

Reverse complement sequence

TGGAAAGACAGAGGGACTCAGCTTTAAAGGATGTTGAAGGTACCAATAATCAATACCTCAAAAGCCATTATCTTCTATATGCTGATTCATTAATGTGAAT[C/A]
TGTTAATGCAGACCGCAAGATCAAGTCCCAGGCACAGTTTGATGTCTTAGTTGACAAGATCAATAGGCTTGAAGGGGCTAGGGACAAAGTCGCTAATGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 0.10% 6.60% 1.16% NA
All Indica  2759 98.40% 0.00% 1.52% 0.11% NA
All Japonica  1512 83.60% 0.40% 12.76% 3.24% NA
Aus  269 95.50% 0.00% 4.46% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 94.40% 0.00% 5.22% 0.38% NA
Temperate Japonica  767 72.80% 0.70% 20.60% 6.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 85.10% 0.40% 13.28% 1.24% NA
VI/Aromatic  96 33.30% 0.00% 63.54% 3.12% NA
Intermediate  90 95.60% 0.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711956562 G -> DEL N N silent_mutation Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0711956562 G -> T LOC_Os07g20680.1 downstream_gene_variant ; 2321.0bp to feature; MODIFIER silent_mutation Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0711956562 G -> T LOC_Os07g20690.1 intron_variant ; MODIFIER silent_mutation Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711956562 3.08E-06 3.08E-06 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 2.10E-06 1.87E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 2.19E-06 3.82E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 6.57E-07 6.57E-07 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 2.87E-06 9.87E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 NA 2.23E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 6.52E-08 3.03E-08 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 NA 7.97E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 NA 1.39E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562 NA 3.56E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251