Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711956562:

Variant ID: vg0711956562 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11956562
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCATTAGCGACTTTGTCCCTAGCCCCTTCAAGCCTATTGATCTTGTCAACTAAGACATCAAACTGTGCCTGGGACTTGATCTTGCGGTCTGCATTAACA[G/T]
ATTCACATTAATGAATCAGCATATAGAAGATAATGGCTTTTGAGGTATTGATTATTGGTACCTTCAACATCCTTTAAAGCTGAGTCCCTCTGTCTTTCCA

Reverse complement sequence

TGGAAAGACAGAGGGACTCAGCTTTAAAGGATGTTGAAGGTACCAATAATCAATACCTCAAAAGCCATTATCTTCTATATGCTGATTCATTAATGTGAAT[C/A]
TGTTAATGCAGACCGCAAGATCAAGTCCCAGGCACAGTTTGATGTCTTAGTTGACAAGATCAATAGGCTTGAAGGGGCTAGGGACAAAGTCGCTAATGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	0.10%	6.60%	1.16%	NA
All Indica	2759	98.40%	0.00%	1.52%	0.11%	NA
All Japonica	1512	83.60%	0.40%	12.76%	3.24%	NA
Aus	269	95.50%	0.00%	4.46%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	94.40%	0.00%	5.22%	0.38%	NA
Temperate Japonica	767	72.80%	0.70%	20.60%	6.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	85.10%	0.40%	13.28%	1.24%	NA
VI/Aromatic	96	33.30%	0.00%	63.54%	3.12%	NA
Intermediate	90	95.60%	0.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711956562	G -> DEL	N	N	silent_mutation	Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N
vg0711956562	G -> T	LOC_Os07g20680.1	downstream_gene_variant ; 2321.0bp to feature; MODIFIER	silent_mutation	Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N
vg0711956562	G -> T	LOC_Os07g20690.1	intron_variant ; MODIFIER	silent_mutation	Average:42.581; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711956562	3.08E-06	3.08E-06	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	2.10E-06	1.87E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	2.19E-06	3.82E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	6.57E-07	6.57E-07	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	2.87E-06	9.87E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	NA	2.23E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	6.52E-08	3.03E-08	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	NA	7.97E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	NA	1.39E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711956562	NA	3.56E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251