\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711927385:

Variant ID: vg0711927385 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11927385
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGAAGGTCTGACTCGTAGTCGACAACATGGTAGTCTTCCTCCTCGAATCCGTGCCTGGCGAGATCAGAGATAGTGCTTTCGTATCTCCTGACGGTATC[C/T]
AGATACACCGTAGGGGAATAACTATGCCTATCCCTGAAGTCGATATCCGGCGGCGTGTCTTGGCTTACGTAGGGTTGTATGTTGTGGCTTCTAGTGGGCG

Reverse complement sequence

CGCCCACTAGAAGCCACAACATACAACCCTACGTAAGCCAAGACACGCCGCCGGATATCGACTTCAGGGATAGGCATAGTTATTCCCCTACGGTGTATCT[G/A]
GATACCGTCAGGAGATACGAAAGCACTATCTCTGATCTCGCCAGGCACGGATTCGAGGAGGAAGACTACCATGTTGTCGACTACGAGTCAGACCTTCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 6.60% 2.07% 6.47% NA
All Indica  2759 98.80% 0.00% 0.83% 0.36% NA
All Japonica  1512 63.60% 20.20% 1.32% 14.95% NA
Aus  269 80.30% 0.00% 17.84% 1.86% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 0.10% 2.80% 1.27% NA
Temperate Japonica  767 74.40% 0.30% 0.91% 24.38% NA
Tropical Japonica  504 38.10% 59.30% 1.98% 0.60% NA
Japonica Intermediate  241 82.20% 1.70% 1.24% 14.94% NA
VI/Aromatic  96 31.20% 0.00% 5.21% 63.54% NA
Intermediate  90 87.80% 5.60% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711927385 C -> DEL N N silent_mutation Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0711927385 C -> T LOC_Os07g20630.1 downstream_gene_variant ; 584.0bp to feature; MODIFIER silent_mutation Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0711927385 C -> T LOC_Os07g20650.1 downstream_gene_variant ; 4398.0bp to feature; MODIFIER silent_mutation Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0711927385 C -> T LOC_Os07g20640.1 intron_variant ; MODIFIER silent_mutation Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711927385 6.38E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 4.01E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 5.03E-07 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 9.57E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 1.19E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 4.43E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 5.76E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 1.51E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 6.06E-06 1.35E-09 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 8.11E-06 8.11E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 4.15E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 2.30E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 1.96E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711927385 NA 2.70E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251