\
| Variant ID: vg0711927385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11927385 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTGAAGGTCTGACTCGTAGTCGACAACATGGTAGTCTTCCTCCTCGAATCCGTGCCTGGCGAGATCAGAGATAGTGCTTTCGTATCTCCTGACGGTATC[C/T]
AGATACACCGTAGGGGAATAACTATGCCTATCCCTGAAGTCGATATCCGGCGGCGTGTCTTGGCTTACGTAGGGTTGTATGTTGTGGCTTCTAGTGGGCG
CGCCCACTAGAAGCCACAACATACAACCCTACGTAAGCCAAGACACGCCGCCGGATATCGACTTCAGGGATAGGCATAGTTATTCCCCTACGGTGTATCT[G/A]
GATACCGTCAGGAGATACGAAAGCACTATCTCTGATCTCGCCAGGCACGGATTCGAGGAGGAAGACTACCATGTTGTCGACTACGAGTCAGACCTTCAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 6.60% | 2.07% | 6.47% | NA |
| All Indica | 2759 | 98.80% | 0.00% | 0.83% | 0.36% | NA |
| All Japonica | 1512 | 63.60% | 20.20% | 1.32% | 14.95% | NA |
| Aus | 269 | 80.30% | 0.00% | 17.84% | 1.86% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 0.10% | 2.80% | 1.27% | NA |
| Temperate Japonica | 767 | 74.40% | 0.30% | 0.91% | 24.38% | NA |
| Tropical Japonica | 504 | 38.10% | 59.30% | 1.98% | 0.60% | NA |
| Japonica Intermediate | 241 | 82.20% | 1.70% | 1.24% | 14.94% | NA |
| VI/Aromatic | 96 | 31.20% | 0.00% | 5.21% | 63.54% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711927385 | C -> DEL | N | N | silent_mutation | Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 | N | N | N | N |
| vg0711927385 | C -> T | LOC_Os07g20630.1 | downstream_gene_variant ; 584.0bp to feature; MODIFIER | silent_mutation | Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 | N | N | N | N |
| vg0711927385 | C -> T | LOC_Os07g20650.1 | downstream_gene_variant ; 4398.0bp to feature; MODIFIER | silent_mutation | Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 | N | N | N | N |
| vg0711927385 | C -> T | LOC_Os07g20640.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.868; most accessible tissue: Minghui63 young leaf, score: 85.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711927385 | 6.38E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 4.01E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | 5.03E-07 | NA | mr1083 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 9.57E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 1.19E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 4.43E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 5.76E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 1.51E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | 6.06E-06 | 1.35E-09 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | 8.11E-06 | 8.11E-06 | mr1335_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 4.15E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 2.30E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 1.96E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711927385 | NA | 2.70E-14 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |