\
| Variant ID: vg0711906132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11906132 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.25, others allele: 0.00, population size: 28. )
GTTCCTCCGTCAAGCTGCGTCCGTTCGTCGCCTGCGTTTCGTCAAGTTGCTGCAGCCCTGTCGTCGTCTTCGTCCTCGGCTCTGCGTCGTCAAGCATTGC[G/A]
CCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCATCGTCCCCGAGCCATCTCCGCCGCGCCCGTTCGTCT
AGACGAACGGGCGCGGCGGAGATGGCTCGGGGACGATGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGG[C/T]
GCAATGCTTGACGACGCAGAGCCGAGGACGAAGACGACGACAGGGCTGCAGCAACTTGACGAAACGCAGGCGACGAACGGACGCAGCTTGACGGAGGAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.30% | 17.60% | 5.06% | 3.00% | NA |
| All Indica | 2759 | 68.90% | 22.10% | 8.16% | 0.83% | NA |
| All Japonica | 1512 | 84.10% | 7.70% | 0.46% | 7.80% | NA |
| Aus | 269 | 92.20% | 7.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 84.00% | 0.70% | 15.29% | 0.00% | NA |
| Indica II | 465 | 31.40% | 56.10% | 12.47% | 0.00% | NA |
| Indica III | 913 | 75.90% | 22.90% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 71.40% | 17.40% | 8.27% | 2.93% | NA |
| Temperate Japonica | 767 | 73.80% | 13.70% | 0.91% | 11.60% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 2.90% | 0.00% | 12.03% | NA |
| VI/Aromatic | 96 | 22.90% | 76.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 16.70% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711906132 | G -> DEL | N | N | silent_mutation | Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| vg0711906132 | G -> A | LOC_Os07g20590.1 | downstream_gene_variant ; 2184.0bp to feature; MODIFIER | silent_mutation | Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| vg0711906132 | G -> A | LOC_Os07g20600.1 | downstream_gene_variant ; 2587.0bp to feature; MODIFIER | silent_mutation | Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| vg0711906132 | G -> A | LOC_Os07g20610.1 | downstream_gene_variant ; 3705.0bp to feature; MODIFIER | silent_mutation | Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| vg0711906132 | G -> A | LOC_Os07g20590-LOC_Os07g20600 | intergenic_region ; MODIFIER | silent_mutation | Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711906132 | NA | 2.78E-08 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 5.84E-08 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 5.14E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 8.33E-07 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 1.52E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | 3.01E-06 | 3.01E-06 | mr1753 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 3.13E-06 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 5.25E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 2.80E-09 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 4.23E-08 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 8.98E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711906132 | NA | 1.66E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |