\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711906132:

Variant ID: vg0711906132 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11906132
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.25, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCTCCGTCAAGCTGCGTCCGTTCGTCGCCTGCGTTTCGTCAAGTTGCTGCAGCCCTGTCGTCGTCTTCGTCCTCGGCTCTGCGTCGTCAAGCATTGC[G/A]
CCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCATCGTCCCCGAGCCATCTCCGCCGCGCCCGTTCGTCT

Reverse complement sequence

AGACGAACGGGCGCGGCGGAGATGGCTCGGGGACGATGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGG[C/T]
GCAATGCTTGACGACGCAGAGCCGAGGACGAAGACGACGACAGGGCTGCAGCAACTTGACGAAACGCAGGCGACGAACGGACGCAGCTTGACGGAGGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 17.60% 5.06% 3.00% NA
All Indica  2759 68.90% 22.10% 8.16% 0.83% NA
All Japonica  1512 84.10% 7.70% 0.46% 7.80% NA
Aus  269 92.20% 7.10% 0.74% 0.00% NA
Indica I  595 84.00% 0.70% 15.29% 0.00% NA
Indica II  465 31.40% 56.10% 12.47% 0.00% NA
Indica III  913 75.90% 22.90% 1.20% 0.00% NA
Indica Intermediate  786 71.40% 17.40% 8.27% 2.93% NA
Temperate Japonica  767 73.80% 13.70% 0.91% 11.60% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 2.90% 0.00% 12.03% NA
VI/Aromatic  96 22.90% 76.00% 0.00% 1.04% NA
Intermediate  90 77.80% 16.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711906132 G -> DEL N N silent_mutation Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0711906132 G -> A LOC_Os07g20590.1 downstream_gene_variant ; 2184.0bp to feature; MODIFIER silent_mutation Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0711906132 G -> A LOC_Os07g20600.1 downstream_gene_variant ; 2587.0bp to feature; MODIFIER silent_mutation Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0711906132 G -> A LOC_Os07g20610.1 downstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0711906132 G -> A LOC_Os07g20590-LOC_Os07g20600 intergenic_region ; MODIFIER silent_mutation Average:65.234; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711906132 NA 2.78E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 5.84E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 5.14E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 8.33E-07 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 1.52E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 3.01E-06 3.01E-06 mr1753 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 3.13E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 5.25E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 2.80E-09 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 4.23E-08 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 8.98E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711906132 NA 1.66E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251