\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711878666:

Variant ID: vg0711878666 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11878666
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGTAGACTTGATAAGCTTTCCATGAAGTACTTGCACGCCCAAATCGGAGTTCGCATGAAGTCGTGGCGGCCGTCAGAAATTGGCGCTGCCCTGCAGT[C/T]
CGAATCCACCCCGCGCGAATCCTCTCCCCTTTGAATCCTCTCCATTGTTCCTGAGTAAAACACGAGTGCACGCGTCTCCGGGGTATAAAGAAGAGGAATA

Reverse complement sequence

TATTCCTCTTCTTTATACCCCGGAGACGCGTGCACTCGTGTTTTACTCAGGAACAATGGAGAGGATTCAAAGGGGAGAGGATTCGCGCGGGGTGGATTCG[G/A]
ACTGCAGGGCAGCGCCAATTTCTGACGGCCGCCACGACTTCATGCGAACTCCGATTTGGGCGTGCAAGTACTTCATGGAAAGCTTATCAAGTCTACTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 8.40% 0.72% 7.49% NA
All Indica  2759 98.30% 0.00% 0.36% 1.27% NA
All Japonica  1512 56.50% 25.70% 1.32% 16.47% NA
Aus  269 95.50% 0.00% 0.00% 4.46% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 94.30% 0.10% 1.27% 4.33% NA
Temperate Japonica  767 66.60% 3.40% 2.09% 27.90% NA
Tropical Japonica  504 30.40% 68.80% 0.20% 0.60% NA
Japonica Intermediate  241 79.30% 6.20% 1.24% 13.28% NA
VI/Aromatic  96 40.60% 0.00% 2.08% 57.29% NA
Intermediate  90 85.60% 8.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711878666 C -> DEL LOC_Os07g20560.1 N frameshift_variant Average:49.248; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0711878666 C -> T LOC_Os07g20560.1 missense_variant ; p.Gly1147Glu; MODERATE nonsynonymous_codon ; G1147E Average:49.248; most accessible tissue: Minghui63 flag leaf, score: 71.116 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711878666 6.55E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 2.78E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 5.28E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 1.05E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 4.03E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 2.38E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 6.53E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 4.87E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 5.30E-06 5.63E-10 mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 6.09E-06 6.08E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 3.64E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 1.04E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 7.72E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 1.45E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 5.65E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 6.63E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 6.27E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 1.84E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 1.76E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 5.78E-15 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711878666 NA 3.09E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251