\
| Variant ID: vg0711805910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11805910 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGATCGGCTGAGTCTGAGTCGAGCTAAATAAGCCGATATAGCCGATTCCGACAATACGACTTGTACGCGACATCGGGTTCAAGTTGATGTATTTCAAGAT[A/G]
ATTGCCACGCATGGATAGAGTCCTAGGAAGGCAATTGTATCTATTAATTAAGATATTTTATGTAAATCCCTTATAGATAAGTGTGGGCAAAAGTCTGCCG
CGGCAGACTTTTGCCCACACTTATCTATAAGGGATTTACATAAAATATCTTAATTAATAGATACAATTGCCTTCCTAGGACTCTATCCATGCGTGGCAAT[T/C]
ATCTTGAAATACATCAACTTGAACCCGATGTCGCGTACAAGTCGTATTGTCGGAATCGGCTATATCGGCTTATTTAGCTCGACTCAGACTCAGCCGATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 25.40% | 0.21% | 8.63% | NA |
| All Indica | 2759 | 97.00% | 1.30% | 0.00% | 1.67% | NA |
| All Japonica | 1512 | 6.40% | 74.90% | 0.33% | 18.39% | NA |
| Aus | 269 | 94.80% | 0.40% | 0.00% | 4.83% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.00% | 2.30% | 0.00% | 5.73% | NA |
| Temperate Japonica | 767 | 2.10% | 66.50% | 0.52% | 30.90% | NA |
| Tropical Japonica | 504 | 13.70% | 85.70% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 5.00% | 78.80% | 0.41% | 15.77% | NA |
| VI/Aromatic | 96 | 26.00% | 0.00% | 4.17% | 69.79% | NA |
| Intermediate | 90 | 60.00% | 34.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711805910 | A -> DEL | N | N | silent_mutation | Average:45.991; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0711805910 | A -> G | LOC_Os07g20430.1 | upstream_gene_variant ; 2279.0bp to feature; MODIFIER | silent_mutation | Average:45.991; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0711805910 | A -> G | LOC_Os07g20450.1 | downstream_gene_variant ; 4148.0bp to feature; MODIFIER | silent_mutation | Average:45.991; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0711805910 | A -> G | LOC_Os07g20440.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.991; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711805910 | NA | 1.72E-07 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | 1.47E-06 | 1.27E-27 | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 3.63E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 1.04E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 1.10E-16 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 8.34E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 1.05E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 2.70E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 3.05E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 7.97E-25 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 7.56E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 2.43E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 4.41E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 7.30E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 9.15E-33 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 1.04E-32 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 5.41E-21 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 9.13E-15 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805910 | NA | 1.37E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |