\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711805867:

Variant ID: vg0711805867 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11805867
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAGAGCAGGAATCGGTTGGAGTCCGGATCGGCTATGGTTAGGATCGGCTGAGTCTGAGTCGAGCTAAATAAGCCGATATAGCCGATTCCGACAATAC[G/A]
ACTTGTACGCGACATCGGGTTCAAGTTGATGTATTTCAAGATAATTGCCACGCATGGATAGAGTCCTAGGAAGGCAATTGTATCTATTAATTAAGATATT

Reverse complement sequence

AATATCTTAATTAATAGATACAATTGCCTTCCTAGGACTCTATCCATGCGTGGCAATTATCTTGAAATACATCAACTTGAACCCGATGTCGCGTACAAGT[C/T]
GTATTGTCGGAATCGGCTATATCGGCTTATTTAGCTCGACTCAGACTCAGCCGATCCTAACCATAGCCGATCCGGACTCCAACCGATTCCTGCTCTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 26.50% 0.36% 8.40% NA
All Indica  2759 96.90% 1.40% 0.00% 1.67% NA
All Japonica  1512 6.30% 75.10% 0.73% 17.86% NA
Aus  269 79.60% 15.60% 0.00% 4.83% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 91.70% 2.50% 0.00% 5.73% NA
Temperate Japonica  767 2.00% 66.80% 1.30% 29.99% NA
Tropical Japonica  504 13.70% 85.70% 0.00% 0.60% NA
Japonica Intermediate  241 5.00% 79.30% 0.41% 15.35% NA
VI/Aromatic  96 26.00% 1.00% 6.25% 66.67% NA
Intermediate  90 56.70% 38.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711805867 G -> DEL N N silent_mutation Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0711805867 G -> A LOC_Os07g20430.1 upstream_gene_variant ; 2236.0bp to feature; MODIFIER silent_mutation Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0711805867 G -> A LOC_Os07g20450.1 downstream_gene_variant ; 4191.0bp to feature; MODIFIER silent_mutation Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg0711805867 G -> A LOC_Os07g20440.1 intron_variant ; MODIFIER silent_mutation Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711805867 NA 6.89E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867 NA 9.81E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867 NA 2.63E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867 NA 9.76E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867 NA 9.43E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867 3.19E-06 3.19E-06 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251