\
| Variant ID: vg0711805867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11805867 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAACAGAGCAGGAATCGGTTGGAGTCCGGATCGGCTATGGTTAGGATCGGCTGAGTCTGAGTCGAGCTAAATAAGCCGATATAGCCGATTCCGACAATAC[G/A]
ACTTGTACGCGACATCGGGTTCAAGTTGATGTATTTCAAGATAATTGCCACGCATGGATAGAGTCCTAGGAAGGCAATTGTATCTATTAATTAAGATATT
AATATCTTAATTAATAGATACAATTGCCTTCCTAGGACTCTATCCATGCGTGGCAATTATCTTGAAATACATCAACTTGAACCCGATGTCGCGTACAAGT[C/T]
GTATTGTCGGAATCGGCTATATCGGCTTATTTAGCTCGACTCAGACTCAGCCGATCCTAACCATAGCCGATCCGGACTCCAACCGATTCCTGCTCTGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 26.50% | 0.36% | 8.40% | NA |
| All Indica | 2759 | 96.90% | 1.40% | 0.00% | 1.67% | NA |
| All Japonica | 1512 | 6.30% | 75.10% | 0.73% | 17.86% | NA |
| Aus | 269 | 79.60% | 15.60% | 0.00% | 4.83% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 91.70% | 2.50% | 0.00% | 5.73% | NA |
| Temperate Japonica | 767 | 2.00% | 66.80% | 1.30% | 29.99% | NA |
| Tropical Japonica | 504 | 13.70% | 85.70% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 5.00% | 79.30% | 0.41% | 15.35% | NA |
| VI/Aromatic | 96 | 26.00% | 1.00% | 6.25% | 66.67% | NA |
| Intermediate | 90 | 56.70% | 38.90% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711805867 | G -> DEL | N | N | silent_mutation | Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0711805867 | G -> A | LOC_Os07g20430.1 | upstream_gene_variant ; 2236.0bp to feature; MODIFIER | silent_mutation | Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0711805867 | G -> A | LOC_Os07g20450.1 | downstream_gene_variant ; 4191.0bp to feature; MODIFIER | silent_mutation | Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg0711805867 | G -> A | LOC_Os07g20440.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711805867 | NA | 6.89E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805867 | NA | 9.81E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805867 | NA | 2.63E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805867 | NA | 9.76E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805867 | NA | 9.43E-08 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711805867 | 3.19E-06 | 3.19E-06 | mr1852_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |