\
| Variant ID: vg0711760152 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11760152 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATGCTGCTTTCGCAAATGAGCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATATTTTGCTGTGTGGCTTGTTGAGTATGTCATATGCTC[A/T]
TTCTTGCAATAATCATCAAACCTCAGTTGAAGAAAAAGGATCCAGAAGGAGAAGACCTTTGGCTTAGATCCCAGTTGAGCTGCCTGTGGGAGTGGAGCTG
CAGCTCCACTCCCACAGGCAGCTCAACTGGGATCTAAGCCAAAGGTCTTCTCCTTCTGGATCCTTTTTCTTCAACTGAGGTTTGATGATTATTGCAAGAA[T/A]
GAGCATATGACATACTCAACAAGCCACACAGCAAAATATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGCTCATTTGCGAAAGCAGCATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 3.40% | 1.52% | 2.07% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 80.00% | 10.20% | 4.17% | 5.62% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.00% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 64.30% | 17.50% | 7.30% | 10.95% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 7.10% | 2.90% | 0.41% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 5.21% | 11.46% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711760152 | A -> DEL | N | N | silent_mutation | Average:48.636; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| vg0711760152 | A -> T | LOC_Os07g20370.1 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:48.636; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| vg0711760152 | A -> T | LOC_Os07g20360-LOC_Os07g20370 | intergenic_region ; MODIFIER | silent_mutation | Average:48.636; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711760152 | 3.54E-06 | 5.60E-08 | mr1182 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711760152 | NA | 9.33E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711760152 | 2.64E-06 | 1.21E-07 | mr1650 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |