\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711689812:

Variant ID: vg0711689812 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11689812
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAGAAGAGAAGTACATCATGAAAATGAGCCCTTTTCAAGGGTCTCTTCTCTCAGTCACACAATAGTTTATTTCGCCATCCAAATTCACGGGATCCCC[G/A]
ATCACAATGGACAGGTTTCCACTATTGTGCAACCTTAGGTGGGTATCAAGCCCATTTCCCTCGATGCACTGTCTATCACATTACGTGGTAGCCCATTAGT

Reverse complement sequence

ACTAATGGGCTACCACGTAATGTGATAGACAGTGCATCGAGGGAAATGGGCTTGATACCCACCTAAGGTTGCACAATAGTGGAAACCTGTCCATTGTGAT[C/T]
GGGGATCCCGTGAATTTGGATGGCGAAATAAACTATTGTGTGACTGAGAGAAGAGACCCTTGAAAAGGGCTCATTTTCATGATGTACTTCTCTTCTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 7.70% 2.20% 12.15% NA
All Indica  2759 89.10% 0.00% 2.03% 8.92% NA
All Japonica  1512 57.40% 23.50% 2.51% 16.60% NA
Aus  269 95.20% 0.00% 0.37% 4.46% NA
Indica I  595 75.00% 0.00% 4.20% 20.84% NA
Indica II  465 95.10% 0.00% 1.72% 3.23% NA
Indica III  913 99.60% 0.00% 0.11% 0.33% NA
Indica Intermediate  786 84.00% 0.00% 2.80% 13.23% NA
Temperate Japonica  767 68.20% 0.40% 3.52% 27.90% NA
Tropical Japonica  504 31.00% 67.50% 0.99% 0.60% NA
Japonica Intermediate  241 78.40% 5.00% 2.49% 14.11% NA
VI/Aromatic  96 29.20% 0.00% 7.29% 63.54% NA
Intermediate  90 83.30% 10.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711689812 G -> DEL N N silent_mutation Average:35.008; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0711689812 G -> A LOC_Os07g20270.1 upstream_gene_variant ; 2548.0bp to feature; MODIFIER silent_mutation Average:35.008; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0711689812 G -> A LOC_Os07g20280.1 downstream_gene_variant ; 318.0bp to feature; MODIFIER silent_mutation Average:35.008; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0711689812 G -> A LOC_Os07g20270-LOC_Os07g20280 intergenic_region ; MODIFIER silent_mutation Average:35.008; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711689812 NA 2.14E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 5.43E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 6.06E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 6.94E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 1.83E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 4.61E-06 6.09E-10 mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 1.54E-06 1.54E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 5.51E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 6.52E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 3.95E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 1.16E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 2.25E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 8.39E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 4.22E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 1.99E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 2.99E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 1.07E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 9.63E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 1.19E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 7.72E-16 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 4.15E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711689812 NA 2.06E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251