Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711639300:

Variant ID: vg0711639300 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11639300
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCATCTCTTAAGGGACGTGCATCCCTGTGCTCCTCTTCTCCTTTTCACCAAGCCACGGAGCCAGAGCTCCGCAAAGGGCGACGTCGTGCCTAGTCCTC[A/G]
CACTCCCGCACTAGTATTTGCTTCATCGTTGGTTGCGGAAGCCTATGGTGGTGGACAAGAGCCGGAGACGATGGCGACAACGACTTGAGCAGCTCGAGTG

Reverse complement sequence

CACTCGAGCTGCTCAAGTCGTTGTCGCCATCGTCTCCGGCTCTTGTCCACCACCATAGGCTTCCGCAACCAACGATGAAGCAAATACTAGTGCGGGAGTG[T/C]
GAGGACTAGGCACGACGTCGCCCTTTGCGGAGCTCTGGCTCCGTGGCTTGGTGAAAAGGAGAAGAGGAGCACAGGGATGCACGTCCCTTAAGAGATGACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.00%	9.60%	1.42%	62.95%	NA
All Indica	2759	2.50%	2.30%	2.25%	92.93%	NA
All Japonica	1512	74.30%	19.50%	0.07%	6.08%	NA
Aus	269	0.40%	4.80%	1.49%	93.31%	NA
Indica I	595	3.40%	0.20%	3.19%	93.28%	NA
Indica II	465	5.20%	0.00%	3.01%	91.83%	NA
Indica III	913	1.00%	0.30%	0.99%	97.70%	NA
Indica Intermediate	786	2.00%	7.60%	2.54%	87.79%	NA
Temperate Japonica	767	65.20%	33.10%	0.00%	1.69%	NA
Tropical Japonica	504	85.90%	0.60%	0.20%	13.29%	NA
Japonica Intermediate	241	79.30%	15.80%	0.00%	4.98%	NA
VI/Aromatic	96	0.00%	80.20%	0.00%	19.79%	NA
Intermediate	90	38.90%	6.70%	0.00%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711639300	A -> DEL	N	N	silent_mutation	Average:16.53; most accessible tissue: Callus, score: 90.012	N	N	N	N
vg0711639300	A -> G	LOC_Os07g20150.1	upstream_gene_variant ; 2642.0bp to feature; MODIFIER	silent_mutation	Average:16.53; most accessible tissue: Callus, score: 90.012	N	N	N	N
vg0711639300	A -> G	LOC_Os07g20160.1	upstream_gene_variant ; 1364.0bp to feature; MODIFIER	silent_mutation	Average:16.53; most accessible tissue: Callus, score: 90.012	N	N	N	N
vg0711639300	A -> G	LOC_Os07g20164.1	upstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:16.53; most accessible tissue: Callus, score: 90.012	N	N	N	N
vg0711639300	A -> G	LOC_Os07g20160-LOC_Os07g20164	intergenic_region ; MODIFIER	silent_mutation	Average:16.53; most accessible tissue: Callus, score: 90.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711639300	NA	4.01E-08	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0711639300	NA	4.14E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711639300	NA	4.10E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711639300	8.25E-06	8.25E-06	mr1468	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711639300	1.69E-06	2.85E-06	mr1608	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711639300	NA	1.54E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711639300	NA	3.61E-08	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251