\
| Variant ID: vg0711639300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11639300 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGTCATCTCTTAAGGGACGTGCATCCCTGTGCTCCTCTTCTCCTTTTCACCAAGCCACGGAGCCAGAGCTCCGCAAAGGGCGACGTCGTGCCTAGTCCTC[A/G]
CACTCCCGCACTAGTATTTGCTTCATCGTTGGTTGCGGAAGCCTATGGTGGTGGACAAGAGCCGGAGACGATGGCGACAACGACTTGAGCAGCTCGAGTG
CACTCGAGCTGCTCAAGTCGTTGTCGCCATCGTCTCCGGCTCTTGTCCACCACCATAGGCTTCCGCAACCAACGATGAAGCAAATACTAGTGCGGGAGTG[T/C]
GAGGACTAGGCACGACGTCGCCCTTTGCGGAGCTCTGGCTCCGTGGCTTGGTGAAAAGGAGAAGAGGAGCACAGGGATGCACGTCCCTTAAGAGATGACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.00% | 9.60% | 1.42% | 62.95% | NA |
| All Indica | 2759 | 2.50% | 2.30% | 2.25% | 92.93% | NA |
| All Japonica | 1512 | 74.30% | 19.50% | 0.07% | 6.08% | NA |
| Aus | 269 | 0.40% | 4.80% | 1.49% | 93.31% | NA |
| Indica I | 595 | 3.40% | 0.20% | 3.19% | 93.28% | NA |
| Indica II | 465 | 5.20% | 0.00% | 3.01% | 91.83% | NA |
| Indica III | 913 | 1.00% | 0.30% | 0.99% | 97.70% | NA |
| Indica Intermediate | 786 | 2.00% | 7.60% | 2.54% | 87.79% | NA |
| Temperate Japonica | 767 | 65.20% | 33.10% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 85.90% | 0.60% | 0.20% | 13.29% | NA |
| Japonica Intermediate | 241 | 79.30% | 15.80% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 0.00% | 80.20% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 38.90% | 6.70% | 0.00% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711639300 | A -> DEL | N | N | silent_mutation | Average:16.53; most accessible tissue: Callus, score: 90.012 | N | N | N | N |
| vg0711639300 | A -> G | LOC_Os07g20150.1 | upstream_gene_variant ; 2642.0bp to feature; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Callus, score: 90.012 | N | N | N | N |
| vg0711639300 | A -> G | LOC_Os07g20160.1 | upstream_gene_variant ; 1364.0bp to feature; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Callus, score: 90.012 | N | N | N | N |
| vg0711639300 | A -> G | LOC_Os07g20164.1 | upstream_gene_variant ; 3252.0bp to feature; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Callus, score: 90.012 | N | N | N | N |
| vg0711639300 | A -> G | LOC_Os07g20160-LOC_Os07g20164 | intergenic_region ; MODIFIER | silent_mutation | Average:16.53; most accessible tissue: Callus, score: 90.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711639300 | NA | 4.01E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0711639300 | NA | 4.14E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711639300 | NA | 4.10E-06 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711639300 | 8.25E-06 | 8.25E-06 | mr1468 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711639300 | 1.69E-06 | 2.85E-06 | mr1608 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711639300 | NA | 1.54E-08 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711639300 | NA | 3.61E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |