\
| Variant ID: vg0711574253 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11574253 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AACCTAAACCAAAGCGATTCCAATTTTATTAGAATTAATTGTTAGCCCATCCTTTGATCTTAAACCCATCCTTTCATTCTCAATCCAAATATCCAAATTC[T/C]
TCCTTTTGATCTAGCCACCAATTTAATCTCTGTGGCTTGATTTCCTCTTTGGCACAAGAATAGTATTATTGCAAATATTGTGAATAATTGCTCTTGTGCT
AGCACAAGAGCAATTATTCACAATATTTGCAATAATACTATTCTTGTGCCAAAGAGGAAATCAAGCCACAGAGATTAAATTGGTGGCTAGATCAAAAGGA[A/G]
GAATTTGGATATTTGGATTGAGAATGAAAGGATGGGTTTAAGATCAAAGGATGGGCTAACAATTAATTCTAATAAAATTGGAATCGCTTTGGTTTAGGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.60% | 8.00% | 7.22% | 51.23% | NA |
| All Indica | 2759 | 3.60% | 13.30% | 10.29% | 72.78% | NA |
| All Japonica | 1512 | 89.70% | 0.10% | 2.38% | 7.80% | NA |
| Aus | 269 | 5.90% | 1.10% | 2.60% | 90.33% | NA |
| Indica I | 595 | 0.70% | 1.00% | 9.41% | 88.91% | NA |
| Indica II | 465 | 3.70% | 12.00% | 16.34% | 67.96% | NA |
| Indica III | 913 | 0.80% | 27.80% | 9.09% | 62.32% | NA |
| Indica Intermediate | 786 | 9.00% | 6.60% | 8.78% | 75.57% | NA |
| Temperate Japonica | 767 | 90.20% | 0.00% | 4.43% | 5.35% | NA |
| Tropical Japonica | 504 | 86.50% | 0.00% | 0.00% | 13.49% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.40% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 8.33% | 11.46% | NA |
| Intermediate | 90 | 45.60% | 2.20% | 6.67% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711574253 | T -> DEL | N | N | silent_mutation | Average:12.596; most accessible tissue: Callus, score: 39.672 | N | N | N | N |
| vg0711574253 | T -> C | LOC_Os07g19530.1 | upstream_gene_variant ; 3951.0bp to feature; MODIFIER | silent_mutation | Average:12.596; most accessible tissue: Callus, score: 39.672 | N | N | N | N |
| vg0711574253 | T -> C | LOC_Os07g19530-LOC_Os07g19540 | intergenic_region ; MODIFIER | silent_mutation | Average:12.596; most accessible tissue: Callus, score: 39.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711574253 | NA | 2.79E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | 1.71E-06 | NA | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 4.11E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 6.56E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 1.65E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 1.23E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 4.77E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 2.71E-33 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711574253 | NA | 1.39E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |