\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711574253:

Variant ID: vg0711574253 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11574253
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACCTAAACCAAAGCGATTCCAATTTTATTAGAATTAATTGTTAGCCCATCCTTTGATCTTAAACCCATCCTTTCATTCTCAATCCAAATATCCAAATTC[T/C]
TCCTTTTGATCTAGCCACCAATTTAATCTCTGTGGCTTGATTTCCTCTTTGGCACAAGAATAGTATTATTGCAAATATTGTGAATAATTGCTCTTGTGCT

Reverse complement sequence

AGCACAAGAGCAATTATTCACAATATTTGCAATAATACTATTCTTGTGCCAAAGAGGAAATCAAGCCACAGAGATTAAATTGGTGGCTAGATCAAAAGGA[A/G]
GAATTTGGATATTTGGATTGAGAATGAAAGGATGGGTTTAAGATCAAAGGATGGGCTAACAATTAATTCTAATAAAATTGGAATCGCTTTGGTTTAGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 8.00% 7.22% 51.23% NA
All Indica  2759 3.60% 13.30% 10.29% 72.78% NA
All Japonica  1512 89.70% 0.10% 2.38% 7.80% NA
Aus  269 5.90% 1.10% 2.60% 90.33% NA
Indica I  595 0.70% 1.00% 9.41% 88.91% NA
Indica II  465 3.70% 12.00% 16.34% 67.96% NA
Indica III  913 0.80% 27.80% 9.09% 62.32% NA
Indica Intermediate  786 9.00% 6.60% 8.78% 75.57% NA
Temperate Japonica  767 90.20% 0.00% 4.43% 5.35% NA
Tropical Japonica  504 86.50% 0.00% 0.00% 13.49% NA
Japonica Intermediate  241 95.00% 0.40% 0.83% 3.73% NA
VI/Aromatic  96 77.10% 3.10% 8.33% 11.46% NA
Intermediate  90 45.60% 2.20% 6.67% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711574253 T -> DEL N N silent_mutation Average:12.596; most accessible tissue: Callus, score: 39.672 N N N N
vg0711574253 T -> C LOC_Os07g19530.1 upstream_gene_variant ; 3951.0bp to feature; MODIFIER silent_mutation Average:12.596; most accessible tissue: Callus, score: 39.672 N N N N
vg0711574253 T -> C LOC_Os07g19530-LOC_Os07g19540 intergenic_region ; MODIFIER silent_mutation Average:12.596; most accessible tissue: Callus, score: 39.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711574253 NA 2.79E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 1.71E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 4.11E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 6.56E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 1.65E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 1.23E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 4.77E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 2.71E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253 NA 1.39E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251