Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711574253:

Variant ID: vg0711574253 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11574253
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCTAAACCAAAGCGATTCCAATTTTATTAGAATTAATTGTTAGCCCATCCTTTGATCTTAAACCCATCCTTTCATTCTCAATCCAAATATCCAAATTC[T/C]
TCCTTTTGATCTAGCCACCAATTTAATCTCTGTGGCTTGATTTCCTCTTTGGCACAAGAATAGTATTATTGCAAATATTGTGAATAATTGCTCTTGTGCT

Reverse complement sequence

AGCACAAGAGCAATTATTCACAATATTTGCAATAATACTATTCTTGTGCCAAAGAGGAAATCAAGCCACAGAGATTAAATTGGTGGCTAGATCAAAAGGA[A/G]
GAATTTGGATATTTGGATTGAGAATGAAAGGATGGGTTTAAGATCAAAGGATGGGCTAACAATTAATTCTAATAAAATTGGAATCGCTTTGGTTTAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	8.00%	7.22%	51.23%	NA
All Indica	2759	3.60%	13.30%	10.29%	72.78%	NA
All Japonica	1512	89.70%	0.10%	2.38%	7.80%	NA
Aus	269	5.90%	1.10%	2.60%	90.33%	NA
Indica I	595	0.70%	1.00%	9.41%	88.91%	NA
Indica II	465	3.70%	12.00%	16.34%	67.96%	NA
Indica III	913	0.80%	27.80%	9.09%	62.32%	NA
Indica Intermediate	786	9.00%	6.60%	8.78%	75.57%	NA
Temperate Japonica	767	90.20%	0.00%	4.43%	5.35%	NA
Tropical Japonica	504	86.50%	0.00%	0.00%	13.49%	NA
Japonica Intermediate	241	95.00%	0.40%	0.83%	3.73%	NA
VI/Aromatic	96	77.10%	3.10%	8.33%	11.46%	NA
Intermediate	90	45.60%	2.20%	6.67%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711574253	T -> DEL	N	N	silent_mutation	Average:12.596; most accessible tissue: Callus, score: 39.672	N	N	N	N
vg0711574253	T -> C	LOC_Os07g19530.1	upstream_gene_variant ; 3951.0bp to feature; MODIFIER	silent_mutation	Average:12.596; most accessible tissue: Callus, score: 39.672	N	N	N	N
vg0711574253	T -> C	LOC_Os07g19530-LOC_Os07g19540	intergenic_region ; MODIFIER	silent_mutation	Average:12.596; most accessible tissue: Callus, score: 39.672	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711574253	NA	2.79E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	1.71E-06	NA	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	4.11E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	6.56E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	1.65E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	1.23E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	4.77E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	2.71E-33	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711574253	NA	1.39E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251