\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711312780:

Variant ID: vg0711312780 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11312780
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATGAAGATAATGAGATTTTGTTGTTGTGCTTACTTTCTCTTTAATTCAATACCTTATGCTTATGATGATGATATTTAAGCTCCCATAATAATATTCA[T/C]
ATCATGTTTATAAGTGTCTTGCTGGGTACATAAGTACTCACTCTTGCTTAATCTAACATATAGAAGAACCGTTATATGAAGAAGTCCAGAAGGTAGCGAG

Reverse complement sequence

CTCGCTACCTTCTGGACTTCTTCATATAACGGTTCTTCTATATGTTAGATTAAGCAAGAGTGAGTACTTATGTACCCAGCAAGACACTTATAAACATGAT[A/G]
TGAATATTATTATGGGAGCTTAAATATCATCATCATAAGCATAAGGTATTGAATTAAAGAGAAAGTAAGCACAACAACAAAATCTCATTATCTTCATTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 10.70% 2.16% 33.66% NA
All Indica  2759 81.90% 0.90% 0.72% 16.38% NA
All Japonica  1512 2.40% 27.60% 3.97% 66.01% NA
Aus  269 62.50% 15.60% 0.74% 21.19% NA
Indica I  595 67.90% 1.00% 0.17% 30.92% NA
Indica II  465 87.70% 1.70% 0.65% 9.89% NA
Indica III  913 95.40% 0.10% 0.00% 4.49% NA
Indica Intermediate  786 73.50% 1.40% 2.04% 23.03% NA
Temperate Japonica  767 2.10% 42.00% 6.65% 49.28% NA
Tropical Japonica  504 1.80% 10.10% 1.19% 86.90% NA
Japonica Intermediate  241 5.00% 18.30% 1.24% 75.52% NA
VI/Aromatic  96 17.70% 4.20% 16.67% 61.46% NA
Intermediate  90 48.90% 18.90% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711312780 T -> DEL N N silent_mutation Average:45.717; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0711312780 T -> C LOC_Os07g19110.1 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:45.717; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N
vg0711312780 T -> C LOC_Os07g19090-LOC_Os07g19110 intergenic_region ; MODIFIER silent_mutation Average:45.717; most accessible tissue: Minghui63 flag leaf, score: 62.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711312780 NA 7.12E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 6.08E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 2.64E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 2.29E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 4.06E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 2.07E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 2.58E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 2.74E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 7.52E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 1.39E-10 mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 8.34E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 5.13E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711312780 NA 1.40E-27 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251